Tải bản đầy đủ

Phân lập và định danh tác nhân gây bệnh đóm là cây cải ngọt





Thành phố Hồ Chí minh



Giáo viên hƣớng dẫn: Sinh viên thƣc hiện:

Thành phố Hồ Chí Minh





Professor Student

HCMC, 09/2006


Xin chân thành gửi lời cảm tạ đến:
 Ban Giám Hiệu Trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh.
 Ban chủ nghiệm Bộ Môn Công Nghệ Sinh Học, cùng tất cả quý thầy cô
đã truyền đạt kiến thức cho chúng tôi.
 TS. Lê Đình Đôn và KS. Hoàng Xuân Quang đã hƣớng dẫn tận tình cho
tôi trong suốt quá trình thực tập và giúp tôi hoàn thành khóa luận tốt
 TS. Bùi Minh Trí, Trƣởng Trung Tâm Phân Tích Hóa – Sinh trƣờng Đại
Học Nông Lâm thành phố Hồ Chí Minh.
 Đặc biệt, xin bày tỏ lòng biết ơn sâu sắc đến cha mẹ, anh chị đã sinh
thành, dạy dỗ và ủng hộ tinh thần cũng nhƣ vật chất cho tôi.
 Các anh chị làm việc tại Trung Tâm Phân Tích Thí Nghiệm Hóa – Sinh
đã hết lòng giúp đỡ, chia sẽ và động viên tôi trong suốt thời gian làm
khóa luận.
 Các bạn sinh viên thực tập tại Trung Tâm Phân Tích Thí Nghiệm Hóa –
Sinh, trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh đã giúp đỡ tôi.
 Các bạn bè thân yêu của lớp Công Nghệ Sinh Học Khóa 28 đã chia sẻ
cùng tôi những vui buồn trong thời gian học cũng nhƣ hết lòng hỗ trợ,
giúp đỡ tôi trong thời gian thực tập.


Đề tài nghiên cứu: “Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt
tại Tp HCM bằng phƣơng pháp PCR và giải trình vùng 16S – 23S rDNA” đƣợc thực
hiện từ ngày 6 tháng 2 năm 2005 đến ngày 30 tháng 7 năm 2006 tại trƣờng Đại Học
Nông Lâm thành phố Hồ Chí Minh, Viện Khoa Học Kỹ Thuật Nông Nghiệp Miền
Đề tài do sinh viên Trần Văn Kỳ thực hiện dƣới sự hƣớng dẫn của TS. Lê Đình
Đôn và KS. Hoàng Xuân Quang.
Đối tƣợng nghiên cứu là vi khuẩn Xanthomonas campestris pv. campestris gây
bệnh đốm lá trên cây cải ngọt. Hiện nay, tại các vùng trồng rau ở Huyện Củ Chi, Hóc
Môn và quận 12, thành phố Hồ Chí Minh, bệnh đốm lá đang gây thiệt hại rất lớn cho
nông dân trồng rau cải ngọt. Triệu chứng điển hình của bệnh là sự xuất hiện các đốm
nhỏ có kích thƣớc 1 – 2 mm trên lá rau. Khi bệnh phát triển, các đốm bệnh lớn dần, có
thể lên kết lại dẫn đến lá rau bị vàng và chết. Bệnh làm giảm năng suất cũng nhƣ chất
lƣợng cây rau cải ngọt.
Mục đích đề tài nhằm định danh tác nhân gây bệnh bằng kỹ thuật PCR, giải trình
tự gen nhằm làm cơ sở cho các nghiên cứu phòng và trị bệnh sau này.
Các nội dung nghiên cứu bao gồm:
1. Phân lập tác nhân gây bệnh từ các mẫu bệnh thu đƣợc từ các vùng trồng rau ở
huyện Củ Chi, Hóc Môn và quận 12, thành phố Hồ Chí Minh.
2. Dùng kỹ thuật PCR và giải trình tự gen nhằm định danh tác nhân gây bệnh.
Kết quả thu đƣợc nhƣ sau:
1. Phân lập đƣợc 8 dòng vi khuẩn gây bệnh đốm lá tại các vùng trồng rau thuộc
huyện Củ Chi, Hóc Môn và quận 12, Tp HCM.
2. Sử dụng kỹ thuật PCR đã khuyếch đại vùng 16S – 23S rDNA ITS làm vật liệu
giải trình tự và gen hrpF đặc trƣng của vi khuẩn gây bệnh.
3. Do hạn chế phƣơng pháp giải trình tự gen không mang lại kết quả. Tuy nhiên,
kết quả PCR cho phép xác định vi khuẩn gây bệnh thuộc giống Xanthomonas
campestris pv. campestris.


Trang tựa
Lời cảm tạ ..................................................................................................................... i
Tóm tắt ........................................................................................................................ ii
Mục lục ...................................................................................................................... iii
Danh sách các chữ viết tắt .......................................................................................... vi
Danh sách các bảng................................................................................................... vii
Danh sách các hình .................................................................................................. viii

1. MỞ ĐẦU .......................................................................................................... 1
1.1. Đặt vấn đề ........................................................................................................ 1
1.2. Mục đích và yêu cầu ........................................................................................ 2
1.2.1. Mục đích ................................................................................................ 2
1.2.2. Yêu cầu .................................................................................................. 3
2. TỔNG QUAN TÀI LIỆU ................................................................................. 4
2.1. Tổng quan nghiên cứu ngoài nƣớc .................................................................. 4
2.1.1. Lịch sử phát hiện và sự phân bố. ........................................................... 4
2.1.2. Tác nhân và triệu chứng bệnh ............................................................... 5
2.1.3. Tác động kinh tế của bệnh. ................................................................... 6
2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh. ...................................... 7
2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh. ............... 8
2.1.6. Phƣơng pháp phân lập và dịnh danh tác nhân gây bệnh ........................ 8
2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây
bệnh bằng phƣơng pháp sinh học phân tử………………….......................10
2.2. Tổng quan nghiên cứu trong nƣớc ................................................................ 12
2.3. Vùng ITS (rDNA intergenic spacer) và gen hrpF
(hypersensitive reaction and pathogenicity). ............................................... 13
2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity). ...................... 13

2.3.2. Ribosome DNA (rDNA). .................................................................... 13
3. VẬT LIỆU VÀ PHƢƠNG PHÁP TIẾN HÀNH ............................................... 15
3.1. Thời gian và địa điểm ................................................................................... 15
3.1.1. Thời gian ............................................................................................. 15
3.1.2. Địa điểm .............................................................................................. 15
3.2. Vật liệu ......................................................................................................... 15
3.3. Hóa chất ........................................................................................................ 15
3.3.1. Các hóa chất dùng ly trích DNA từ vi khuẩn ...................................... 15
3.3.2. Các hóa chất dùng trong điện di .......................................................... 16
3.3.3. Hóa chất cho phản ứng PCR (do công ty Bio – Rad cung cấp) .......... 16
3.3.4. Môi trƣờng ........................................................................................... 17
3.4. Dụng cụ, thiết bị ............................................................................................ 17
3.5. Phƣơng pháp .................................................................................................. 17
3.5.1. Phƣơng pháp thu thập mẫu bệnh ......................................................... 17
3.5.2. Phƣơng pháp phân lập vi sinh vật từ mẫu bệnh .................................. 18
3.5.3. Phƣơng pháp chủng bệnh trên rau cải trồng trong nhà lƣới ................ 18 Phƣơng pháp trồng cây kí chủ .................................................... 18 Chủng bệnh ................................................................................. 19
3.5.4. Phƣơng pháp ly trích DNA từ vi khuẩn .............................................. 20
3.5.5. Phƣơng pháp PCR ............................................................................... 20 Khuếch đại đoạn DNA trong vùng ITS của vi khuẩn ............. 20 Khuếch đại đọan DNA trong gen hrpF .................................... 22
3.5.6. Phƣơng pháp điện di và đọc kết qủa ................................................... 22 Điện di trên gel agarose ............................................................ 22 Đọc kết quả điện di................................................................... 22
3.5.7. Phƣơng pháp xác định trình tự gen từ sản phẩm PCR. ....................... 23 Chuẩn bị khuôn DNA. .............................................................. 23 Phản ứng đọc trình tự sử dụng BigDye Terminator V3.1
Cycle Sequencing Kit (Applied Biosystems). ............................ 24 Tinh sạch sản phẩm khuếch đại. .............................................. 25 Chạy điện di và ghi nhận tín hiệu trên máy sequencer. ........... 25

v Quy trình tóm tắt các bƣớc đọc trình tự. .................................. 26
4. KẾT QUẢ VÀ THẢO LUẬN ............................................................................... 27
4.1. Kết quả thu thập và phân lập mẫu vi khuẩn gây bệnh. ........................... 27
4.2. Kết quả chủng bệnh trên rau cải ngọt trồng trong nhà lƣới.................... 28
4.3. Kết quả ly trích và pha loãng DNA vi khuẩn. ....................................... 31
4.4. Kết quả phản ứng PCR. ......................................................................... 32
4.4.1. Kết quả PCR khuếch đại vùng ITS. ............................................... 32
4.4.2. Kết quả điện di tinh sạch sản phẩm PCR ....................................... 32
4.4.3. Kết quả PCR khuếch đại vùng hrpF. ............................................. 33
5. KẾT LUẬN VÀ ĐỀ NGHỊ ................................................................................... 34
TÀI LIỆU THAM KHẢO ......................................................................................... 36
PHỤ LỤC .................................................................................................................. 39

CTAB :Cethyltrimethylammonium bromide
EDTA :Ethyleneediamine tetraacetic acid
ng : nano gram
cDNA : complementary DNA
nm : nano mol
g : micro gram
m : micro mol
M : micro mol/lít
l : micro lít
TE : tris EDTA
dNTP : deoxyribonucleotide – 5 – trphosphate
TAE : tris acetic EDTA
UI : unit international
bp : base pair
Kb : kilo base
SDS : Sodium dodecyl sulphate
PDA : Potato Dextrose agar
RFLP : Restriction Fragment Lengh Polymorphism
RAPD : Random Amplification of Polymorphic DNA
Tm : melting temperature
ctv : cộng tác viên
PCR : Polymerase Chains Reaction
UV : Ultra violet
CC : Củ Chi
HM : Hóc Môn
Q12 : Quận 12
DC : Đối chứng



Bảng 1.1 Sự phát triển của một số loài vi khuẩn Xanthomonas trên
môi trƣờng bán chọn lọc.....................................................................9
Bảng 3.1 Thành phần phản ứng PCR………………………………………... 20
Bảng 3.2 Chu trình nhiệt phản ứng PCR với cặp mồi Xan1330 và Xan 322…21
Bảng 3.3 Chu trình nhiệt phản ứng PCR với cặp mồi XCR và XCF……….. 21
Bảng 3.4 Lƣợng DNA tối ƣu cho phản ứng đọc trình tự………………………. 23
Bảng 3.5 Thành phần hóa chất cho mỗi phản ứng đọc trình tự……………... 24
Bảng 4.1 Danh mục các dòng vi khuẩn sử dụng trong đề tài………………... 26



Hình 2.1 Sản phẩm rep – PCR trong nghiên cứu của
Youfu Zhao và ctv…………………………………........................10
Hình 2.2 Cấu trúc vùng 16S – 23S rDNA ITS của vi khuẩn
Hình 3.1 Sơ đồ tóm tắt quy trình đọc trình tự sản phẩm PCR………………...25
Hình 4.1 Lá cải bị bệnh thu thập ngoài ruộng rau…………………………… 26
Hình 4.2 Vết bệnh trên lá cải thu thập ngoài ruộng chụp dƣới kính
hiển vi soi nổi….…….…………………………………………… 27
Hình 4.3 Nuôi cấy vi khuẩn trên môi trƣờng thạch………………………….. 27
Hình 4.4Vết bệnh sau khi chủng và vết thƣơng không bị nhiễm chụp
dƣới kính hiển vi soi nổi……………………………………………28
Hình 4.5 Lá cải sau khi chủng bệnh 4 ngày, bên phải gân lá không bị nhiễm và
bên trái bị nhiễm……………………………………………………29
Hình 4.6 Kết quả ly trích DNA từ các dòng vi khuẩn…………………..….... 30
Hình 4.7 Kết quả hiệu chỉnh nồng độ DNA………………………………….. 30
Hình 4.8 Kết quả khuếch đại vùng 16S – 23S rDNA………………………... 31
Hình 4.9 Kết quả tinh sạch sản phẩm PCR…………………………………... 32
Hình 4.10 Kết quả khuếch đại đoạn DNA vùng hrpF…………….…………. 32

Chƣơng 1. MỞ ĐẦU
1.1. Đặt vấn đề
Cây rau cải nằm trong họ thập tự đƣợc trồng phổ biến ở khắp châu Âu,
Địa Trung Hải, nơi đƣợc coi là nguồn gốc của chúng (Nguyễn Văn Thắng, Trần Khắc
Thi, 1996). Chúng đƣợc sử dụng rộng rãi làm thức ăn cho ngƣời và gia súc,
làm nguyên liệu nghành dƣợc. Cây cải chiếm vị trí quan trọng bậc nhất trong
ngành rau nhờ chủng loại phong phú, sản lƣợng cao, thích nghi rộng rãi với điều kiện
thời tiết, đất đai khác nhau, dễ vận chuyển, cất giữ lâu, dễ ăn, dễ chế biến và nấu
Rau là loại thực phẩm không thể thiếu trong bữa ăn hằng ngày của con ngƣời,
đặc biệt là với các dân tộc Châu Á và nhất là với ngƣời Việt Nam. Dù ở đâu – trong
nƣớc hay ngoài nƣớc – bữa ăn của ngƣời Việt Nam luôn có món rau với số lƣợng
nhiều hơn so với của các dân tộc khác. Có lẽ vì vậy mà ngƣời Việt trẻ hơn, đẹp hơn so
với ngƣời cùng lứa tuổi của các châu lục khác.
Theo sự phát triển của đời sống xã hội, nhiều nhà dinh dƣỡng học của Việt Nam
cũng nhƣ của thế giới nghiên cứu về khẩu phần thức ăn cho nguời Việt Nam đã
tính rằng hàng ngày chúng ta cần khoảng 2300 – 2500 calo năng lƣợng để sống và
hoạt động. Để có đƣợc năng lƣợng này, nhu cầu tiêu dùng rau hằng ngày trung
bình cho một ngƣời phải vào khoảng 250 – 300 g (tức là khoảng 7,5 – 9 kg/ngƣời
mỗi tháng). Còn nghiên cứu của nhà khoa học Pháp, ông Dorolle từ năm 1942 đã
tính là khoảng 360 g/ngày (tức là khoảng 10,8 kg/một tháng cho mổi ngƣời). Theo
các số liệu thống kê thì hiện nay tính bình quân chung cả nƣớc chúng ta mới sản
xuất đƣợc khoảng 4 – 5 kg/ngƣời mỗi tháng (không tính phần sản xuất tự túc trong
dân) (Nguyễn Văn Thắng và Trần Khắc Thi, 1996).
Nhƣng tác dụng của rau không phải là bảo đảm số calo chủ yếu trong khẩu phần
dinh dƣỡng mà là cung cấp đủ chất xơ (xenlulo) để kích thích hoạt động của nhu mô
ruột và các sinh tố (vitamin) cho cơ thể.
Ở phía nam nƣớc ta, cải ngọt đƣợc trồng nhiều ở các tỉnh nhƣ: Tp HCM, Đồng Nai,
Lâm Đồng, Long An. Cùng các loại rau khác, cải ngọt đã mang lại nhiều lợi ích thiết
thực cho đời sống con ngƣời nhƣ cung cấp rau tƣơi, bổ sung nguồn dinh dƣỡng, chất
xơ cũng nhƣ các loại vitamin. Trong một vài năm trở lại đây, do tốc độ đô thị hóa diễn

ra nhanh, các khu công nghiệp tập trung số lƣợng lớn công nhân, do vậy nhu cầu
lƣợng rau xanh hàng ngày rất lớn. Chính vì vậy, cây cải ngọt (Brassica chinensis L.)
đƣợc nông dân quan tâm, chọn trồng nhiều do chúng có những đặc tính sinh
trƣởng phù hợp cho việc thu hoạch thƣờng xuyên nhƣ: thời gian sinh trƣởng ngắn
(30 – 35 ngày), trồng đƣợc quanh năm, có nhiều giống trồng trong cả mùa khô và mùa
mƣa, năng suất cao, đáp ứng đƣợc nhu cầu của thị trƣờng.
Đối với cây cải ngọt, do hàm lƣợng nƣớc lớn, trên 90% (Mai Thị Vinh và Phạm Văn
Biên, 1985) nên là ký chủ thích hợp cho nhiều loại vi sinh vật gây bệnh nhƣ nấm, vi
khuẩn. Nhóm vi khuẩn gây bệnh trên cây cải ngọt bao gồm: vi khuẩn gây thối nhũn,
cháy lá chữ V, đốm lá. Bệnh đốm lá vi khuẩn không phải là đối tƣợng quan trọng.
Nhƣng hiện nay, khi diện tích gieo trồng tăng, trồng nhiều vụ trong năm, có sự tích lũy
nguồn bệnh qua các vụ, nó trở thành vấn đề đƣợc nhiều ngƣời quan tâm.
Triệu chứng ban đầu của bệnh là các đốm nhỏ xuất hiện ở bề mặt dƣới của lá. Vết
bệnh dạng tròn, sũng nƣớc, đƣờng kính từ 1 – 3 mm. Vết bệnh lúc già thì phần mô ở
giữa bị hoại tử, nhìn mặt trên lá sẽ thấy các đốm màu nâu. Bệnh cũng xuất hiện ở phần
thân và cuống lá làm cho lá bị cong lại và vết bệnh có màu đen.
Bệnh làm giảm năng suất, giá trị thƣơng phẩm của rau, giảm thời gian bảo quản nên
giá trị kinh tế không cao. Hơn nữa, ngoài cải ngọt, bệnh cũng gây hại trên khá nhiều
các loại cây trồng khác cùng họ thập tự nhƣ: cải bắp, súp lơ, cải thảo, cải xanh. Chính
vì vậy, xác định đƣợc tác nhân gây bệnh là việc cần thiết nhằm làm cơ sở cho các
nghiên cứu phòng trừ sau này.
Đó là lý do tôi chọn thực hiện đề tài: “Phân lập và định danh tác nhân gây bệnh
đốm lá cây cải ngọt tại Tp. HCM bằng phƣơng pháp PCR và giải trình tự vùng
16S – 23S rDNA”. Đề tài là một phần trong chƣơng trình nghiên cứu bệnh vi khuẩn
trên cây họ thập tự của Bộ môn Bảo Vệ Thực Vật, Đại Học Nông Lâm
Tp. HCM.
1.2. Mục đích và yêu cầu của đề tài
1.2.1. Mục đích
Định danh tác nhân gây bệnh đốm lá trên cây cải ngọt làm cơ sở cho các nghiên
cứu sâu hơn sau này nhằm phòng trừ bệnh có hiệu quả, giảm thiểu thiệt hại cho
nông dân trồng rau.

1.2.2. Yêu cầu
- Thu thập mẫu bệnh phẩm tại các vùng trồng rau Củ Chi, quận 12, Hóc Môn.
- Phân lập vi sinh vật từ mẫu bệnh phẩm.
- Chủng bệnh trên cây rau cải trồng trong nhà lƣới.
- Chọn lọc các dòng vi khuẩn gây bệnh trong số các dòng thu thập đƣợc dựa
vào kết quả chủng bệnh.
- Ly trích DNA và thực hiện phản ứng PCR định danh tác nhân gây bệnh.
- Đọc trình tự vùng 16S – 23S rDNA.

2.1. Tổng quan nghiên cứu ngoài nƣớc
2.1.1. Lịch sử phát hiện và sự phân bố

Vi khuẩn gây bệnh đốm lá trên cây rau họ thập tự phân bố rộng rãi, chúng đã đƣợc
ghi nhận là có mặt ở khoảng 85 quốc gia khắp Châu Phi, Châu Á, Bắc Mỹ và Nam Mỹ
(Bradbury, 1986).
Bệnh đƣợc ghi nhận lần đầu tiên vào năm 1929 trên cây cải ngựa, năm 1930 phát
hiện trên củ cải trắng và củ cải đỏ (Youfu Zhao và ctv, 2005). Bệnh cũng đƣợc tìm
thấy ở nhiều vùng thuộc nƣớc Mỹ nhƣ Riverside, Santa Barbara, Santa Clara
(Matsumoto, 1975).
Bệnh này đƣợc ghi nhận gây hại trên họ thập tự ở Argentina (Gaetan, 1995) và ở
Brazil trong năm 1992 (Leit, 1994). Ở miền bắc Ấn Độ trong những năm từ
1989 – 1992 bệnh xuất hiện và gây hại nặng trên cây cải bông (Shyam, 1994). Vi kuẩn
gây bệnh đã đƣợc tìm thấy từ hạt cải bắp ở Nhật Bản năm 1988 (Shiomi, 1992). Ở Hàn
Quốc, đốm lá là bệnh quan trọng trên cây cải bắp (Kim, 1986). Schaad và Taveechi
(1983) đã báo cáo rằng: bệnh xuất hiện ở vùng phía bắc, tây bắc và miền trung Thái
Theo CPC (Crop protection compendium) (2001) cho đến nay, bệnh đã xuất hiện
trên nhiều quốc gia khác nhau. Ở châu Âu bao gồm: Bungary, CH Séc, Đan Mạch,
Pháp, Đức, Hy Lạp, Hungary, Iceland, Ireland, Ý Hà Lan, Na Uy, Bồ Đào Nha,
Rumani, Nga, Thụy Điển, Thụy Sĩ, Anh. Ở châu Á bao gồm các quốc gia nhƣ: Brunei,
Cam Pu Chia, Trung Quốc, Đài Loan, Tây Tạng, Ấn Độ, Inđônêxia, Iran, Nhật, Hàn
Quốc, Malayxia, Nêpan, Philippin, Srilanka, Thái Lan, Thổ Nhĩ Kỳ, Uzbêkistan và
Việt Nam. Châu Phi gồm có: Angola, Ethiopia, Ghana, Kenya, Libya, Malawi,
Mauritius, Morocco, Mozambique, Seychelles, Somalia, Tanzania, Togo, Uganda,
Zimbabwe. Ở vùng tây bán cầu có các quốc gia nhƣ: Argentina, Barbados, Bermuda,
Bolivia, Brazil, Parana, Canada, British Columbia, Costa Rica, Cuba, Dominica, El
Salvador, Guatemala, Haiti, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto
Rico. Ở nƣớc Mỹ, bệnh xuất hiện ở các bang nhƣ: California, Florida, Georgia,
Hawaii, Illinois, Michigan, New York, Washington, Wisconsin. Ở châu Đại Dƣơng
bệnh xuất hiện ở American Samoa, New South Wales. Ở Úc, bệnh xuất hiện ở các
khu vực nhƣ: Queensland, Nam Úc, Tây Úc. Ngoài ra, bệnh cũng đƣợc ghi nhận là đã
có mặt Cook Islands, Fiji New Caledonia, New Zealand, Norfolk Island, Papua New
Guinea, Tonga.

Nhƣ vậy, chúng ta thấy rằng đây là bệnh phân bố khá rộng rãi, hầu nhƣ chúng
có mặt ở hầu hết các quốc gia trên thế giới.
2.1.2. Tác nhân và triệu chứng bệnh
Theo Lowell L. Black (2000), bệnh do vi khuẩn Xanthomonas campestris pv.
armoraciae gây nên. Bệnh xuất hiện trên tất cả các loại cây trồng thuộc họ thập tự và
một số giống cải hoang.
Triệu chứng chính của bệnh là đốm trên lá thật, đôi khi bệnh cũng xuất hiện trên lá
mầm, bông, cuống lá và bắp của cây cải bắp. Các đốm nhỏ xuất hiện trên bề mặt lá do
sự xâm nhiễm qua lỗ khí khổng của vi khuẩn hoặc rìa mép lá do quá trình xâm nhiễm
qua lỗ thủy khổng. Vết bệnh ban đầu là các lỗ nhỏ sũng nƣớc, về sau khi triệu chứng
bệnh điển hình, đƣờng kính vết bệnh có thể lên đến 3 mm và có dạng hình tròn.
Bao quanh vết bệnh là vành màu nâu sáng, khi bệnh già ở giữa có vùng hoại tử màu
trắng. Vết bệnh trên gân, cuống lá thƣờng có dạng sọc đen dài.
Youfu Zhao và ctv (2000, 2002) đã phân lập các vi khuẩn gây bệnh đốm lá trên các
cây trồng họ thập tự ở Oklahoma (cải bắp, cải rổ, cải củ, cải thìa) là Xanthomonas
campestris pv. armoraciae, Xanthomonas campestris pv. campestris, Pseudomonas
syringae pv. maculicola. Trong đó hai loài vi khuẩn Xanthomonas campestris
pv. armoraciae, Xanthomonas campestris pv. campestris là những tác nhân quan
trọng. những vi khuẩn này cùng tồn tại và phát triển trên đồng ruộng.
Vi khuẩn Xanthomonas campestris pv. campestris thuờng gây triệu chứng cháy lá
chữ V (V – shape), đôi lúc cũng có triệu chứng đốm lá, nếu xâm nhiễm qua lỗ thủy
khổng. Vi khuẩn Xanthomonas campestris pv. armoraciae gây triệu chứng đốm lá.
Đối với bệnh đốm lá do vi khuẩn Pseudomonas syringae pv. maculicola gây triệu
chứng đốm lá, vết bệnh thƣờng không định hình, kích thƣớc vết bệnh khoảng 2 mm,
khi nhiều vết bệnh liên kết lại với nhau, đƣờng kính vết bệnh có thể lên tới 1 cm.
Màu sắc vết bệnh thƣờng có dạng sũng nƣớc, viền úa vàng bao quanh vết bệnh.
Trong nghiên cứu của mình về bệnh đốm lá trên cây canola (Brassica napus), một
loại cây trồng thuộc họ thập tự, S. Geatan, N. Lopez (2005) đã xác định rằng, tác nhân
của bệnh này là do vi khuẩn Xanthomonas campestris gây nên. Vi khuẩn xâm nhiễm
qua lỗ khí khổng tạo nên các vết đốm hoại tử. Triệu chứng bệnh đôi lúc có dạng cháy
lá chữ V, đó là kết quả của sự xâm nhiễm qua lỗ thủy khổng ở mép lá.

Từ tháng 12 năm 2001, K. Pernezn, E. Dickstein phát hiện dịch bệnh đốm lá cải
bắp ở trang trại vùng Everglades thuộc phía nam bang Florida. Triệu chứng là các đốm
nhỏ, kích thƣớc khoảng 1 – 2 mm và thƣờng xuất hiện ở phần mặt lá. Tác nhân là do vi
khuẩn Xanthomonas campestris pv. armoraciae gây nên.
Xanthomonas campestris pv. campestris và các chủng khác thuộc loại này nhƣ
X. campestris pv. abbrans, raphani, armmoraciae, và incanae đƣợc biết đến nhƣ là
những chủng gây bệnh đốm lá hoặc cháy lá chữ V trên các cây trồng họ thập tự
(J.G. Vicente, 2001).
Cũng theo J.G. Vicente và ctv (2006) phân lập và định danh tác nhân gây bệnh
đốm lá trên cây củ cải trắng và cây cải ngựa (horseradish), kết quả cho thấy, tác nhân
gây bệnh là vi khuẩn Xanthomonas campesrtis pv. armoraciae hoặc Xanthomonas
campesrtis pv. raphani.
Ở Queensland, Australia, tác nhân gây bệnh đốm lá họ thập tự do vi khuẩn
Xanthomonas campestris pv. campestris gây nên. Vi khuẩn thƣờng gây hại mạnh trên
các giống cải (Moffett, M.L và ctv, 1976).
Nhƣ vậy, tác nhân gây bệnh đốm lá họ tập tự cho đến nay bao gồm hai
giống chính, giống Xanthomonas bao gồm: Xanthomonas campestris pv. armoraciae,
Xanthomonas campestris pv. campestris, Xanthomonas campesrtis pv. raphani.
Và giống Pseudomonas gồm có: Pseudomonas syringae pv. maculicola.
2.1.3. Tác động kinh tế của bệnh
Bệnh đốm lá vi khuẩn họ thập tự phân bố rộng rãi, gây hại nhiều loại cây trồng có
giá trị kinh tế cao. Ở Oklahoma, hàng năm có khoảng 600 ha rau bị bệnh tấn công.
Bệnh làm giảm năng suất và chất lƣợng của một số loại rau ăn lá họ thập tự. Từ 1994
đến 1996 bệnh làm thiệt hại hoàn toàn những cánh đồng trồng cải rổ, cải xanh, củ cải ở
bang này (Youfu Zhao và ctv, 2000).
Theo CPC (2001), bệnh đốm lá họ thập tự là bệnh quan trọng gây tổn thất đáng
kể về năng suất cũng nhƣ chất lƣợng. Bệnh là đối tƣợng nguy hiểm cho cây trồng họ
thập tự ở các bang phía bắc nƣớc Mỹ. Trong những năm 1960 và 1970, bệnh gây hại
rất nặng rên cánh đồng trồng cải bắp của bang Texas. Năm 1972 và 1973, bệnh đã gây
thành dịch cho các khu vực Đông – Bắc, và các bang phía tây nƣớc Mỹ, khoảng 70%
cây con lấy từ típ ƣơm cây đều bị nhiễm bệnh, sự thiệt hại này ƣớc tính là khoảng

1 triệu USD. Ở Canada, trong vụ Đông 1979 – 1980, bệnh gây tổn thất khoảng 60%
sản lƣợng cải bắp.
Ở miền nam tỉnh Buenos Aires – Argentina, tỷ lệ bệnh đốm lá cây canola (Brassica
napus) trung bình koảng 59%, những năm bệnh nặng, tỷ lệ bệnh khoảng 90% và làm
thất thoát khoảng 20% năng suất (S. Geatan, N. Lopez, 2005).
Các loài gây bệnh thuộc giống Xanthomonas spp. Là vi khuẩn gây tổn thất kinh tế
nặng nề nhất trên các cây trồng họ thập tự nhƣ cải bông, cải bắp, cải xanh
(J.G. Vicente và ctv, 2006).
2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh.
Vi khuẩn Xanthomonas campestris pv. armoraciae tồn tại trong tàn dƣ cây trồng ở
trong đất, nhƣng không sống trong đất sau khi tàn dƣ cây trồng bị phân hủy. Vi khuẩn
cũng có thể tồn tại trên cây cỏ, hạt giống. Bệnh phát triển mạnh khi có ẩm độ lá cao
(trên 85%), khoảng nhiệt độ thích hợp để bệnh phát triển tƣơng đối rộng 20 – 30
Trong điều kiện thời tiết có sƣơng hoặc mƣa liên tục kết hợp với nhiệt độ cao là điều
kiện rất thuận lợi để bệnh phát triển mạnh mẽ. Vi khuẩn có thể lan từ cây này qua cây
khác do mƣa, tƣới và các dụng cụ lao động (Lowell L. Black, 2000).
Theo Youfu Zhao (2002), vi khuẩn gây bệnh lan truyền qua hạt giống là chủ yếu.
nếu bệnh do Xanthomonas campestris pv. campestris gây nên thì vi khuẩn có thể
tồn tại cả ở hạt giống, tàn dƣ thực vật và cỏ dại. Chƣa phát hiện đƣợc sự tồn tại và
lan truyền qua đất và tồn dƣ cây trồng của vi khuẩn gây bệnh là Xanthomonas
campestris pv. armoraciae.
Vi khuẩn Xanthomonas campestris pv. armoraciae và Pseudomonas syringae
pv. maculicola gây bệnh đốm lá cây rau ăn lá họ thập tự gần nhƣ không tồn tại trong
tàn dƣ cây trồng đƣợc chôn vùi sâu, nhƣng chúng tồn tại lâu hơn trong tàn dƣ cây
trồng trên mặt đất. Điều này cũng tƣơng tự nhƣ vi khuẩn gây bệnh Pseudomonas
syringae pv. phaseolicola. Chúng có thể tồn tại lâu hơn trong tồn dƣ thực vật trên mặt
đất. Vi khuẩn gây bệnh cũng tồn tại trong tồn dƣ thực vật đã bị hoai mục.
Cũng nhƣ các vi khuẩn gây bệnh khác, vi khuẩn Xanthomonas campestris
pv. armoraciae có quan hệ chặt chẽ với sự xâm nhiễm vào mô lá qua lỗ hở tự nhiên
(khí khổng, thủy khổng) và các vết thƣơng tạo nên hiện tƣợng đốm lá (Veronique
Hugouvieux, 1998).

Theo CPC (2001), Xanthomonas campestris pv. campestris sống sót qua mùa đông
trong đất, đặc biệt là các cây kí chủ nhiễm bệnh và các loài cỏ dại mọc gần ruộng trồng
cây họ thập tự, vi khuẩn có thể tồn tại tới 3 năm. Vi khuẩn xâm nhập vào hạt, lỗ khí
khổng và thủy khổng của cây. Vi khuẩn từ lá mầm ở cây con có thể lan truyền trực
tiếp lên các lá thật. Vi khuẩn xâm nhập vào cây qua sự hình thành giọt nƣớc tiết ra từ
lỗ thủy khổng trong giai đoạn buổi sáng (Ruisen và Gielink, 1993).
Nhiệt độ thích hợp cho sinh trƣởng của vi khuẩn là 25 – 30
C. Trong những điều
kiện nhƣ vậy, triệu chứng bệnh sẽ xuất hiện sau 7 – 14 ngày. Nhiệt độ thấp, triệu
chứng bệnh xuất hiện chậm. Triệu chứng bệnh không thể hiện rõ khi nhiệt độ dƣới
18 – 20
C. Vi khuẩn có thể sống sót trên bề mặt lá đến 73 ngày sau khi lá đƣợc chủng
bệnh bằng phƣơng pháp phun (Schultz và Gabrielson, 1986). Vi khuẩn có thể lây lan
từ cây này qua cây khác nhờ gió, mƣa và công cụ lao động.
2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh
Các loài vi khuẩn gây bệnh thuộc giống Xanthomonas thƣờng có phản ứng Gram
âm, háo khí, tế bào hình gậy (0,4 – 0,7 x 0,7 – 1,8 μm), tiêm mao đơn cực, không sản
sinh nitrates, phản ứng catalase dƣơng tính, tạo axít yếu từ các nguồn carbonhydrate.
Khuẩn lạc có màu vàng, nhầy, lồi và bóng trên môi trƣờng NGA và YDC agar.
Đối với các loài Xanthomonas, khuẩn lạc có thể mọc và phát triển ở nhiệt độ 35
hóa lỏng gelatin, không tạo urease, sản sinh axit từ arabinose, glucose và manose
(N.W. Schaad, 1998).
2.1.6. Phƣơng pháp phân lập tác nhân gây bệnh
Theo Youfu Zhao (2000), đối với bệnh đốm lá họ thập tự do vi khuẩn thuộc giống
Xanthomonas, việc ly trích vi khuẩn tốt nhất từ các đốm lá mới bị nhiễm bệnh.
Sát trùng bề mặt bằng sodium hypochlorite 0,25% trong 30 giây, đốm bệnh đƣợc cắt
nhỏ trong giọt nƣớc tiệt trùng và cấy zích zắc dịch khuẩn lên môi trƣờng nutrient agar
(NA). Đĩa cấy ủ trong 28
C, sau 3 – 5 ngày đem quan sát khuẩn lạc. Chọn các khuẩn
lạc màu vàng, mọc tách rời để nghiên cứu.
Theo CPC (2001), vi khuẩn gây bệnh thực vật giống Xanthomonas có thể đƣợc
phân lập từ rìa vết bệnh (phần tiếp giáp giữa mô bệnh và mô khỏe ). Vi khuẩn đƣợc
cấy trên môi trƣờng Yeast dextrose calcium carbonate (YDC), Beef peptone agar + 5%
water soluble starch.

Theo Shaad, N.W. (1988), vi khuẩn Xanthomonas campestris pv. campestris có
thể đƣợc phát hiện bằng cách nuôi cấy trên môi trƣờng bán chọn lọc (semiselective
media). Các loại môi trƣờng bán chọn lọc chuyên biệt đƣợc sử dụng là SX agar, SM
agar, NSCAA, BSCAA. Các môi trƣờng này thƣờng dùng phân lập vi khuẩn
Xanthomonas campestris pv. Campestris trong đất và hạt giống.

2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây
bệnh bằng phƣơng pháp sinh học phân tử
Để đánh giá sự đa dạng di truyền các dòng vi khuẩn Xanthomonas
campestris gây bệnh đốm lá trên cây họ thập tự, Youfu Zhao và ctv (2000) đã sử dụng
kỹ thuật rep-PCR với BOX primer BOXAIR [5’ –












Môi trƣờng


















































































Bảng 1.1 Sự
phát triển của một số loài vi khuẩn


trên môi trƣờng

bán chon lọc

CTACGGCAAGGCGACGCTGACG – 3’]. Phản ứng rep – PCR trên các mẫu nghiên
cứu tạo sản phẩm là các đoạn DNA có kích thƣớc từ 0,3 – 4 kb cho phép đánh giá sự
tƣơng quan về mặt kiểu gen giữa các loài.

Hình 2.1 Sản phẩm rep – PCR trong nghiên cứu của Youfu Zhao và ctv.
Goncalves, E.R., và Rosato, Y.B (2002), trong nghiên cứu của mình về sự phát
sinh loài vi khuẩn Xanthomonas campestris đã dùng kỹ thuật PCR sử dụng cặp primer
Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’
Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’
thiết kế dựa trên vùng rDNA 16S và 23S để khuếch đại vùng 16S – 23S rDNA ITS có
kích thƣớc 1,1 kb.


Hình 2.2 Cấu trúc vùng 16S – 23S rDNA ITS của vi khuẩn Xanthomonas.
Said M.S. Massomo và ctv (2003) đã thực hiện nghiên cứu định danh vi khuẩn
Xanthomonas campestris pv. campestris trên cải bắp ở Tanzania bằng phƣơng pháp
chủng bệnh, phân tích methyl este acit béo, ELISA gián tiếp và rep – PCR. Vi khuẩn
sau khi phân lập đƣợc tiến hành phân tích sinh hóa; chủng bệnh bằng phƣơng pháp
châm kim tạo vết thƣơng, lây nhiễm trên lá mầm, phun dịch khuẩn trên cây trƣởng
thành. Acit béo đƣợc methyl hóa, ly trích và phân tích bằng máy sắc ký khí. Vi khuẩn
đƣợc xác định bằng kỹ thuật ELISA gián tiếp sử dụng kháng thể đơn dòng đặc hiệu.
Các dòng vi khuẩn sau khi xác định đƣợc tiến hành phân tích genomic fingerprinting
bằng kỹ thuật rep – PCR với primer
BOXAIR (5’ – CTACggCAAggCgACgCTgACg – 3’)
và REP – PCR dùng cặp primer:
REP 1R (5’ – IIIICgICgICATCIggC – 3’)
REP 2I (5’ – ICgICTTATggCCTAC – 3’).
Young Jin Park và ctv (2004) đã thực hiện nghiên cứu phát hiện vi khuẩn
Xanthomonas campestris pv. campestris bằng kỹ thuật PCR dựa trên cặp primer
XCR (5’ – CTGTTGATGGTGGTCTGCAA – 3’) đƣợc thiết kế từ gen hrpF
của vi khuẩn Xanthomonas campestris pv. campestris để khuếch đại đoạn DNA có

kích thƣớc 535 bp. Nhóm nghiên cứu đã tiến hành thực nghiệm chứng minh tính
chuyên biệt và đặc hiệu của primer XCR, XCF bằng cách thực hiện phản ứng PCR
với nhiều thành phần hóa chất mà máy luân nhiệt khác nhau. Ngoài ra, kỹ thuật
DNA dot – blot cũng đƣợc thực hiện nhằm kiểm chứng sự hiện diện của gen hrpF
trong vi khuẩn, qua đó rút ra kết luận về sự bảo toàn của gen này.
2.2. Tổng quan nghiên cứu trong nƣớc
Cho đến nay, những nghiên cứu về bệnh đốm lá họ thập tự nói chung và cây cải
ngọt nói riêng còn khá ít. Theo Lê Lƣơng Tề và Vũ Triệu Mân (1999), bệnh đốm lá
súp lơ là do vi khuẩn Pseudomonas syringae pv. maculicola gây nên. Bệnh đƣợc phát
hiện lần đầu tiên ở Mỹ vào năm 1911. Triệu chứng bệnh trên các lá thật thƣờng là các
đốm nhỏ, tròn, góc cạnh, màu nâu tím hoặc đen. Trên lá mầm xuất hiện các đốm trong
giọt dầu, mép lá uốn cong. Đƣờng kính vết bệnh từ 1 – 3 mm.
Vi khuẩn gây bệnh hình gậy, hai đầu tròn, kích thƣớc khoảng 1,5 – 3 x 0,5 – 1 μm,
chuyển động nhờ vài ba lông roi ở một đầu. Khuẩn lạc trắng kem, tròn nhẵn, rìa gợn
sóng. Vi khuẩn có khả năng phát huỳnh quang, tạo NH
, khử nitrate, không phân giải
đƣờng thành axít, khí, không làm đông váng sữa, phân giải gelatin rất yếu, khả năng
yếu tạo H
S và indol.
Nhiệt độ thích hợp cho vi khuẩn sinh trƣởng là 24 – 25
C, nhiệt độ tối đa là 29
nhiệt độ gây chết là 47
C, nhạy cảm với tác động của ánh sáng mặt trời và khô hạn.
Vi khuẩn xâm nhiễm qua lỗ khí khổng, vết thƣơng. Thời kỳ ủ bệnh là khoảng
4 – 6 ngày. Bệnh phát triển thuận lợi trong điều kiện ẩm độ cao (90%), nhiệt độ
17 – 25
C. Bệnh có thể lan truyền qua bọ nhảy.
Ở trên cây cải bông và một số rau ăn lá nhƣ cải thìa, cải xanh, cải ngọt, bệnh đốm lá
do vi khuẩn Xanthomonas spp. gây nên thƣờng xuất hiện trong vụ đông xuân.
Trên cải bông, bệnh xuất hiện nhiều hơn so với các giống cải khác (Trần Thanh Tùng,
Theo Phạm Văn Biên và Mai Thị Vinh (1998, 2000), bệnh đốm lá cải bông vùng
trồng rau thành phố HCM do vi khuẩn Pseudomonas spp. gây nên. Bệnh thƣờng xuất
hiện trên cải bông trồng trong vụ đông xuân. Bệnh phát sinh gây hại nặng vào những
năm có thời tiết nóng ẩm. Giống Xanthomonas spp. thƣờng gây bệnh cháy lá chữ V

trên cải bắp, cải bông vùng Củ Chi, Hóc Môn, Bình Chánh. Bệnh cũng thƣờng xuất
hiện trong vụ đông – xuân, khoảng từ tháng 11 – 2.
Trong giống Xanthomonas spp. có một loài gây bệnh đốm lá cải bông đƣợc phát
hiện trong năm 1998 ở vùng rau Vĩnh Lộc B, Bình Chánh, Tp. HCM. Triệu chứng
bệnh ban đầu là các đốm nhỏ vàng sáng ở các lá thấp gần mặt đất, các đốm này trông
gần giống với đốm do bọ nhảy gây hại. Bệnh thƣờng nặng hơn vào giai đoạn cuối vụ.
Tỷ lệ bệnh giai đoạn phát triển thân lá khoảng 21%, nhƣng ở giai đoạn ra bông , bệnh
có thể lên tới 50% (Mai Thị Vinh, 1998).
Nhìn chung, số công trình nghiên cứu về tác nhân cũng nhƣ các đặc tính sinh học,
sinh lý, sinh hóa, dịch tễ học của bệnh đốm lá cải ngọt nói riêng và bệnh đốm lá cây họ
thập tự nói chung ở Việt Nam còn khá ít.
2.3. Vùng 16S – 23S rDNA ITS (rDNA intergenic spacer) và gen hrpF
(hypersensitive reaction and pathogenicity)
2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity)
Để xâm nhập và gây bệnh trên cây kí chủ, các loài vi khuẩn thƣờng có hệ thống
riêng tiết ra các loại enzyme (pectinases, cellulases, proteases) và các chất độc (Beattie
và Lindow, 1994). Ngoài ra còn có sự tham gia của hệ thống các gen hrp. Gen này
hiện diện trong hầu hết các loài vi khuẩn Gram âm ngoại trừ Agrobacterium
(Lindgren, 1986). Gen này tạo cho vi khuẩn khả năng xâm nhập và nhân sinh khối
trong cây nhiễm (susceptible plant), đồng thời tạo phản ứng siêu nhạy cảm
(hypersensitive reaction) ở cây kháng (resistant plant). Phản ứng siêu nhạy cảm là một
đáp ứng phòng vệ của cây kí chủ, thể hiện bằng sự hoại tử ở mô bị nhiễm (Klement,
1982). Tổ hợp gen này bao gồm 21 gen và 2 gen điều tiết là hrpX, hrpG nằm bên
ngoài. Các gen hrp mã hóa các protein hrp. Các protein này là thành phần của hệ
thống phóng tiết loại III (type III secretion system) cho phép tiết ra các loại protein
gây độc (Van Gijsegem, 1993 và Van den Ackerveken, 1996).
2. 3.2. Ribosome DNA (rDNA)
rDNA là nhóm gen mã hóa rRNA của ribosom, đóng vai trò quan trọng trong các
nghiên cứu quan hệ phát sinh loài. rDNA đƣợc quan tâm nghiên cứu vì nó là một gen
có nhiều bản sao và đặc biệt không mã hóa cho protein nào. Các bản sao của gen nằm
liên tiếp trên một locus và liên quan mật thiết tới quá trình tiến hóa. Hơn nữa, ribosom

hầu nhƣ tồn tại trong mọi sinh vật và có cùng nguồn gốc tiến hóa. Phần lớn phân tử
rDNA tƣơng đối bảo tồn nên đƣợc xem là cơ sở để tìm ra sự tƣơng đồng và các khác
biệt khi so sánh các sinh vật khác nhau. Các primer thiết kế dựa trên những
oligonucleotide có tính bảo tồn cao đƣợc sử dụng cho tất cả sinh vật nhằm khuếch đại
các vùng tƣơng đƣơng dùng trong so sánh. Ngoài ra, nhiều primer và probe cũng đƣợc
thiết kế dựa trên các vùng không bảo tồn dùng trong phát hiện và định danh vi sinh vật
(Van de Peer và ctv, 1996).
Theo Goncalves, E.R., và Rosato, Y.B (2002), rDNA 16S và 23S có tính bảo toàn
cao. Ngƣợc lại, vùng ITS tiến hóa nhanh hơn và có nhiều biến động. Do đó, các
primer đƣợc thiết kế dựa trên trình tự các vùng bảo toàn để khuếch vùng ITS, dùng
trong các nghiên cứu về sự đa dạng di truyền, nguồn gốc phát sinh cũng nhƣ quan hệ
giữa các loài. Ngoài ra, vùng ITS còn đƣợc sử dụng giải trình tự, đối chiếu với dữ liệu
trên ngân hàng gen để định danh sinh vật.

Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay
