Tải bản đầy đủ (.pdf) (4 trang)

TÁCH DÒNG, PHÂN TÍCH TRÌNH TỰ ĐOẠN GEN MÃ HÓA ĐỘC TỐ APX IA TỪ ACTINOBACILLUS PLEUROPNEUMONIAE

Bạn đang xem bản rút gọn của tài liệu. Xem và tải ngay bản đầy đủ của tài liệu tại đây (369.51 KB, 4 trang )

(1)

Hoàng Thị Huyền Trang và Đtg Tạp chí KHOA HỌC & CƠNG NGHỆ 180(04): 176 - 180


177

TÁCH DỊNG, PHÂN TÍCH TRÌNH TỰ ĐOẠN GEN MÃ HÓA ĐỘC TỐ APX IA


TỪ ACTINOBACILLUS PLEUROPNEUMONIAE



Hoàng Thị Huyền Trang1, Nguyễn Thị Thu Ngà2,


Dương Văn Cường1, Phạm Bằng Phương3
1Viện Khoa học Sự sống - ĐH Thái Nguyên, 2Trường Đại học Sư phạm – ĐH Thái Nguyên,
3Trường Đại học Nông Lâm – ĐH Thái Ngun


TĨM TẮT


ApxIA là đoạn gen mã hóa protein quy định cấu trúc ngoại độc tố ApxIA gây ra bệnh viêm màng
phổi ở lợn. Nghiên cứu này đã tiến hành tách dòng và xác định trình tự đoạn gen ApxIA từ
A.pleuropneumoniae. Kết quả cho thấy, đoạn gen được phân lập và có kích thước 801 bp mã hóa
cho 120 amino acid vùng peptidase_M10_C và 147 amino acid thuộc vùng RTX C-terminal
domain của protein ApxIA. Khi so sánh với trình tự gen ApxIA (mã số GQ369732.1) trên Genbank
cho thấy trình tự đoạn gen ApxIA từ A pleuropneumoniae phân lập được có ba vị trí nucleotide sai
khác so với gen ApxIA (mã số GQ369732.1). Tuy nhiên, sự sai khác này khơng ảnh hưởng đến
trình tự amino acid thuộc vùng RTX C-terminal domain. Plasmid mang đoạn gen ApxIA được sử
dụng làm nguyên liệu cho các nghiên cứu tiếp theo về thiết kế vector biểu hiện và tinh sạch protein
ApxIA.


Từ khóa: Actinobacillus pleuropneumoniae, gen ApxIA, ngoại độc tố, protein ApxIA ,viêm màng phổi


MỞ ĐẦU*


Viêm màng phổi ở lợn do A.
pleuropneumoniae gây ra là một bệnh truyền



nhiễm, có ảnh hưởng rất lớn đến năng suất
của đàn lợn [4]. Bệnh này được đặc trưng bởi
thương tích xuất huyết, tơ huyết, hoại tử phổi
dẫn đến tử vong cao ở những con lợn bị
nhiễm nặng hoặc những tổn thương phổi nhỏ
cục bộ ở những lợn bị bệnh mạn tính.


Cho đến nay, 15 kiểu huyết thanh của A.


pleuropneumoniae đã được mô tả dựa trên sự


khác nhau của vỏ polysaccharide (CPS) và
của lipopolysaccharide (LPS) thành tế bào, tất
cả các serotype đều có khả năng gây bệnh, tuy
nhiên mức độ biểu hiện độc tính khác nhau
[3]. Nhiều nghiên cứu đã cho thấy mức độ
độc lực khác nhau của các kiểu huyết thanh A.


pleuropneumoniae phần lớn có liên quan đến


ngoại độc tố (Apx) sản sinh từ vi khuẩn này.
Độc tố Apx của A. pleuropneumoniae được
xếp vào nhóm RTX-toxin, bao gồm bốn loại
protein ApxI, ApxII, ApxIII và Apx IV [5].
Trong đó, các chủng sản sinh ra độc tố ApxI
thường có độc lực cao. ApxI là một protein
có trọng lượng phân tử từ 105 -110 kDa, có




*


Tel: 01652 030019, Email: tranghoanghuyendhsptn@gmail.com


độc lực cao, gây dung huyết và có hoạt tính
gây độc tế bào mạnh hướng đại thực bào phế
nang và bạch cầu trung tính. Trước đây, ApxI
được đặt tên là haemolysin I (HlyI) hay
cytolysin I (ClyI) [6]. ApxI được tiết ra bởi A.


pleuropneumoniae serotype 1; 5; 9; 10; 11; 14


[2]. Operon mã hóa cho ApxI được xác định
là gen apxI gồm 4 cistron được sắp xếp theo
thứ tự là apxIC, apxIA, apxIB, và apxID,
trong đó C là gen hoạt hóa, A là gen quy định
cấu trúc độc tố, B và D là hai gen mã hóa cho
các protein kết hợp với màng liên quan đến sự
tiết độc tố qua cả hai màng [4].


Theo Inzana và đồng tác giả (1991) [1], A.


pleuropneumoniae kiểu huyết thanh 5 thể đột


biến không sản sinh ra ApxI hoặc ApxII đã
khơng cịn độc lực đối với lợn hoặc chuột thí
nghiệm. Điều này cho thấy độc tố là yếu tố
quan trọng xác định độc lực của vi khuẩn A.


pleuropneumoniae kiểu huyết thanh 5. Đồng



thời chủng A. pleuropneumoniae này được
dùng làm giống gốc sản xuất vaccine và cho
thấy động vật thí nghiệm khơng có khả năng
bảo hộ đối với các chủng tự nhiên. Kết quả
nghiên cứu chứng minh các độc tố là cần thiết
để kích thích đáp ứng miễn dịch chống lại khả
năng gây bệnh của các chủng A.



(2)

Hoàng Thị Huyền Trang và Đtg Tạp chí KHOA HỌC & CƠNG NGHỆ 180(04): 176 - 180


178


Shin Min-Kyoung và đồng tác giả (2011) [7]
đã chứng minh được tính kháng nguyên của
vùng RTX C-terminal domain thuộc ApxIA
trên 320 lợn thí nghiệm.


Trong nghiên cứu này, đoạn gen ApxIA mã
hóa vùng RTX C-terminal domain thuộc
ApxIA được tách dòng và xác định trình tự
với mục đích tạo nguồn ngun liệu ban đầu
cho việc tạo vaccine đa giá thể phòng bệnh
viêm màng phổi ở lợn.


VẬT LIỆU, PHƯƠNG PHÁP NGHIÊN CỨU


Nguyên liệu


Mẫu A. pleuropneumoniae serotype 5 do


Công ty cổ phần thuốc thú y Đức Hạnh
Marphavet cung cấp.


Các hóa chất chính được sử dụng gồm:
GenJET Genomic DNA Purfication Kit của
Thermo, pGEM®-T Easy Vector system II
của Promega, GeneJET Plasmid miniprep Kit
của Thermo.


Phương pháp nghiên cứu


Dựa trên trình tự gene ApxIA được công bố
trên Genbank (mã số GQ369732.1). Cặp mồi
đặc hiệu để phân lập đoạn gene ApxIA (có
kích thước dự đoán 801 bp) được thiết kế và
bổ sung thêm điểm cắt của enzyme giới hạn


BamHI, HindIII.


ApxIAF:5’GCGGATCCGGAGACGACGG
TAATGATGTA3’


ApxIAR:5’GCAAGCTTTTAAGCAGATTG
TGTTAAATAATTACT 3’


Tách chiết DNA tổng số từ A.
pleuropneumoniae serotype 5 theo hướng dẫn


của GenJET Genomic DNA Purfication kit.
Gen ApxIA được phân lập từ DNA tổng số


bằng phản ứng PCR với cặp mồi đặc hiệu có
chu trình như sau: 94ºC/3 phút; 30 chu kì:
94ºC/30 giây, 55ºC/30 giây, 72ºC/1 phút 30
giây; 72ºC/10 phút. Thành phần phản ứng
PCR bao gồm: Buffer -7,5 μl, dNTPs – 0,3 μl,
mồi xuôi (10 pmol/μl) - 0,5 μl, mồi ngược (10
pmol/μl) - 0,5 μl, DNA khuôn - 0,5 μl, dH2O


-5,7 μl.Tổng thể tích 15 μl.


Đoạn gene ApxIA sau khi phân lập được gắn
vào vector tách dòng pGEM. Sản phẩm tách
dòng được biến nạp vào vi khuẩn E.coli
JM109. Plasmid có chứa gene ApxIA tách
chiết từ các khuẩn lạc sinh trưởng trên môi
trường kháng sinh chọn lọc. Trình tự gen
được xác định trên máy ABI PRISM@ 3100
Advant Genetic Analyzer (Applied
Biosystem). Phân tích trình tự gen bằng
chương trình BLAST trên NCBI và phần
mềm BioEdit.


KẾT QUẢ VÀ THẢO LUẬN


Tách dịng đoạn gen mã hóa độc tố ApxIA


Kết quả phân lập đoạn gen ApxIA bằng kỹ
thuật PCR thu được đoạn DNA có kích thước
khoảng 1 kb, tương ứng với kích thước tính
tốn theo lý thuyết. Sản phẩm PCR thu được


là một băng đặc hiệu, vì vậy được tinh sạch
trực tiếp và sử dụng để tách dịng gen.



Hình 1. Kết quả nhân gen ApxIA từ A.
pleuropneumoniae kiểu huyết thanh 5


(M: Thang DNA chuẩn 1 kb)



Đoạn gen ApxIA sau tinh sạch được gắn vào
vector tách dòng pGEM – 3015 bp. Sản phẩm
gắn nối được biến nạp vào vi khuẩn E. coli
JM109. Khuẩn lạc chứa plamid mang gen


ApxIA được chọn lọc trên môi trường LB


chứa kháng sinh ampicilin, cơ chất X-Gal và
chất cảm ứng IPTG. Các khuẩn lạc trắng
mang vector được nuôi tăng sinh và tách chiết
plasmid. Vector tách dòng pGEM-ApxIA
được cắt bằng hai loại enzyme hạn chế là


BamHI và HindIII cho hai phân đoạn DNA có


kích cỡ khoảng 3 kb và xấp xỉ 0,9 kb (Hình
2). Trong đó, phân đoạn DNA xấp xỉ 0,9 kb


M



1 kb ~ 0,9 kb




(3)

Hoàng Thị Huyền Trang và Đtg Tạp chí KHOA HỌC & CƠNG NGHỆ 180(04): 176 - 180


179
chính là đoạn gen đích (ApxIA) cần thu nhận.


Sản phẩm cắt hạn chế có kích thước khoảng xấp
xỉ 0,9 kb (Hình 2) được thơi gel để thu nhận gen


ApxIA phục vụ cho phân tích trình tự gen ApxIA


và thiết kế vector biểu hiện.


Hình 2.Kết quả cắt vector pGEM- ApxIA bằng
enzyme BamHI và HindIII


(M: Thang DNA chuẩn 1 kb)


Phân tích trình tự gen ApxIA


Gen ApxIA (GQ369732.1) dài 3066 bp, mã
hóa cho 1022 amino acid. Từ vị trí amino acid
8 đến 652 tạo nên vùng RTX N-terminal
domain, từ acid amin 729 đến 845 là vùng
gắn Ca2+


(Ca2+-binding protein), từ amino
acid 739 đến 749 là vùng peptidase_M10_C,
từ amino acid 874 đến 1020 là vùng RTX
C-terminal domain [2]. Đoạn gen ApxIA của A.



pleuropneumoniae kiểu huyết thanh 5 tách


dịng được có kích thước 801 bp. Kết quả so
sánh trình tự nucleotide của đoạn gen ApxIA
tách dịng được và ApxIA (GQ369732.1) bằng
chương trình BLAST trên NCBI cho thấy
mức độ tương đồng giữa 2 gen là 99%. Sự
tương đồng giữa 2 gen bắt đầu từ vị trí
nucleotide tương ứng với vị trí nucleotide
2288 đến 3069 bp của gen ApxIA có mã số
GQ369732.1 (Hình 3).


Trình tự acid amin suy diễn của đoạn gen trên
mã hóa cho 267 amino acid, tương ứng từ vị
trí amino acid 756 đến 1022 của protein
ApxIA do gen ApxIA (GQ369732.1) mã hóa.
Phân tích trình tự nucleotide tương đồng giữa
2 gen cho thấy, có 3 vị trí sai khác được thể
hiện trong bảng 1. Sự sai khác nucleotide ở vị


trí nucleotide 2318 trên gen ApxIA


(GQ369732.1) không dẫn đến sự thay đổi
amino aicd, sự sai khác ở vị trí nucleotide
2321 và 2322 dẫn đến sự thay đổi amino acid
Gln thành Pro. Tuy nhiên amino acid bị thay
đổi là amino acid 774 không nằm trong vùng
RTX C-terminal domain.



Hình 3. Kết quả so sánh trình tự nucleotide ApxIA


của A. pleuropneumoniae kiểu huyết thanh 5
phân lập được và ApxIA (GQ369732.1) trên


Genbank


Bảng 1.Vị trí sai khác trong trình tự nucleotide
(Nu) của gen ApxIA của A. pleuropneumoniae


serotype 5 và ApxIA (GQ369732.1)


S
T
T


Vị
trí
Nu


Nu


ApxI
A


Nu
GQ3697


32.1


Amino
acid


tạo
thành


Amino
acid bị
thay


đổi


1 2318 C T Glu Glu


2 2321 G T Pro Gln


3 2322 A T


Như vậy, đoạn gen phân lập được có thể mã
hóa 120 amino acid thuộc vùng
peptidase_M10_C và trọn vẹn 147 amino acid
thuộc vùng RTX C-terminal domain của
protein ApxIA, đủ điều kiện để tiến hành các
nghiên cứu tiếp theo.


3 kb



1 kb




(4)

Hoàng Thị Huyền Trang và Đtg Tạp chí KHOA HỌC & CƠNG NGHỆ 180(04): 176 - 180


180



KẾT LUẬN


Phân lập được đoạn gen ApxIA từ


Actinobacillus pleuropneumoniae có kích


thước 801 bp mã hóa cho 120 amino acid
vùng peptidase_M10_C và 147 amino acid
thuộc vùng RTX C-terminal domain của
protein ApxIA.


Plasmidmang gen ApxIA được sử dụng để
thiết kế vector biểu hiện mang đoạn gen mã
hóa độc tố ApxIA.


TÀI LIỆU THAM KHẢO


1. Inzana T. J., Todd J., Ma J., & Veit H. (1991),
“Characterization of a non-hemolytic mutant of
Actinobacillus pleuropneumoniae serotype 5: role
of the 110 kilodalton hemolysin in virulence and
immunoprotection”, Microbial pathogenesis,
10(4), pp. 281-296.


2. Lee Ki-Eun, Hwan W. C., Ha H. K., Jae Y. S.,
Dong K. Y. (2015), "Prevalence and
characterization of Actinobacillus
pleuropneumoniae isolated from Korean pigs",


Journal of Bacteriology and Virology, 45(1), pp.


19-25.


3. Moon J. Y., Kang J. Y., Seo J. W., Kim W. K.,
Choi Y. H., Choi M. S., Hur J. (2017), “Efficacy
Evaluation of Combination Vaccine of
Recombinant C-Terminal Fragments of ApxIA,
ApxIIA and ApxIIIA in Piglets”, Sains
Malaysiana, 146(2), pp. 217-221.


4. Ramjeet M., Deslandes V., Gouré J., & Jacques
M. (2008), “Actinobacillus pleuropneumoniae
vaccines: from bacterins to new insights into
vaccination strategies”, Animal Health Research
Reviews, 9(1), pp. 25-45.


5. Sadilkova L., Nepereny J., Vrzal V., Sebo P.,
Osicka R. (2012), “Type IV fimbrial subunit
protein ApfA contributes to protection against


porcine pleuropneumonia”, Veterinary


research, 43, pp. 2.


6. Shin M. K., Kang M. L., Cha S. B., Lee W. J.,
Sung J. H., & Yoo H. S. (2011), “An
immunosorbent assay based on the recombinant
ApxIa, ApxIIa, and ApxIIIa toxins of
Actinobacillus pleuropneumoniae and its
application to field sera”, Journal of veterinary
diagnostic investigation, 23(4), pp. 736-742.



SUMMARY


CLONING AND SEQUENCE ANALYSIS OF GENE CODING FOR APXIA
EXOTOXIN IN ACTINOBACILLUS PLEUROPNEUMONIAE


Hoang Thi Huyen Trang1*, Nguyen Thi Thu Nga2,
Duong Van Cuong1, Pham Bang Puong3


1


TNU - Institute of Life Sciences, 2TNU - University of Education,


3


TNU - University of Agriculture and Forestry


ApxIA is a gene coding for the structural regulation of ApxIA exotoxin that causes pleurisy in pigs.
This study conducted the isolation and sequencing of the ApxIA gene from Actinobacillus
pleuropneumoniae. Results showed that the gene was isolated and 801 bp encoded for 120 amino
acid tin the peptidase_M10_C and 147 amino acids in the RTX C-terminal domain of the ApxIA
protein. When compared to the ApxIA gene sequence (code GQ369732.1) on Genbank, the ApxIA
gene sequence from Actinobacillus pleuropneumoniae isolated from three different nucleotide
positions was different from the ApxIA gene (GQ369732.1). However, this difference does not
affect the amino acid sequence of the RTX C-terminal domain. Plasmid carrying the ApxIA gene
are used as the basis for further studies on the expression vector design and purification of the
ApxIA protein.


Keywords: Actinobacillus pleuropneumoniae, ApxIA gene, Apx IA protein, exotoxin, porcine
pleuropneumoniae



Ngày nhận bài: 06/3/2018; Ngày phản biện: 18/4/2018; Ngày duyệt đăng: 27/4/2018




*





×