Tải bản đầy đủ (.pdf) (6 trang)

NGHIÊN CỨU CHUYỂN GEN GmDREB2 VÀO GIỐNG ĐẬU TƯƠNG ĐT12

Bạn đang xem bản rút gọn của tài liệu. Xem và tải ngay bản đầy đủ của tài liệu tại đây (387.92 KB, 6 trang )

(1)

NGHIÊN CỨU CHUYỂN GEN GmDREB2 VÀO GIỐNG ĐẬU TƯƠNG ĐT12



Phạm Thị Thanh Nhàn*, Phạm Minh Hảo, Nguyễn Thị Ngọc Lan, Chu Hoàng Mậu


Trường Đại học Sư phạm - ĐH Thái Nguyên


TÓM TẮT


Đậu tương (Glycine max (L.) Merrill) là cây trồng có giá trị kinh tế cao. Tuy nhiên, đây là cây mẫn
cảm với điều kiện ngoại cảnh và chịu hạn kém. Đặc tính chịu hạn ở cây đậu tương là tính trạng đa
gen, sản phẩm của các gen này liên quan trực tiếp đến sự biểu hiện của đặc tính chịu hạn hoặc có
chức năng điều hịa nhóm gen chịu hạn. Gen mã hóa nhân tố phiên mã DREB ở cây đậu tương có
chức năng kích hoạt sự phiên mã của nhóm gen chịu hạn, lạnh và mặn. Bài báo này trình bày kết quả
chuyển cấu trúc mang gen GmDREB2 vào giống đậu tương ĐT12 phục vụ tạo dòng cây đậu tương
chuyển gen chịu hạn. Cấu trúc pBI121-GmDREB2 đã được biến nạp thành công vào giống đậu
tương ĐT12 qua mô nách lá mầm thông qua chủng A. tumefaciens. Các mẫu biến nạp được tái sinh
in vitro, chọn lọc bằng kháng sinh và tạo cây đậu tương chuyển gen. Kết quả có 203/300 mẫu biến
nạp tạo đa chồi, 197 chồi chọn lọc trong môi trường kéo dài chồi và số chồi được cho ra rễ là 60.
Số cây chuyển gen trồng trên giá thể là 20 cây và có 5 cây sống sót ở điều kiện nhà lưới, hiệu suất
chuyển gen ở giai đoạn này là 1,67% (5/300). Trong số 5 dòng cây chuyển gen ở thế hệ T0, 4 cây
chuyển gen dương tính với PCR, hiệu suất chuyển gen đạt 1,33% (4/300).


Keywords: Hạn, Glycine max (L.) Merrill, GmDREB2, A. tumefaciens, hiệu suất chuyển gen


ĐẶT VẤN ĐỀ*


Đậu tương (Glycine max (L.) Merrill) là một
cây trồng cạn ngắn ngày có giá trị kinh tế cao.
Ở Việt Nam, việc trồng đậu tương có ba mục
đích là giải quyết vấn đề thiếu protein cho con
người và gia súc, xuất khẩu và cải tạo đất.


Tuy nhiên, đây là cây mẫn cảm với điều kiện
ngoại cảnh và chịu hạn kém nên sản lượng
còn thấp, chưa đáp ứng được nhu cầu tiêu
dùng. Đặc tính chịu hạn ở cây đậu tương là
tính trạng đa gen, sản phẩm của các gen này
liên quan trực tiếp đến sự biểu hiện của đặc
tính chịu hạn hoặc có chức năng điều hịa
nhóm gen chịu hạn. Để chống lại điều kiện
bất lợi của ngoại cảnh, đặc biệt là hạn hán, cơ
thể thực vật đã sản xuất ra nhiều loại protein,
trong đó có DREB (Dehydration- Responsive
Element Binding). DREB có vai trị kích hoạt
nhóm gen chịu hạn phiên mã. Họ protein này
có chứa vùng bảo thủ duy nhất để gắn với
trình tự DNA đặc hiệu là
APETALA2/Ethylene Responsive Factor
(AP2/ERF), cho phép chúng tương tác với
một loạt các gen phía sau theo hình thức
không phụ thuộc axit abscisic. Các miền
AP2/ERF có khoảng 60 amino acid [50], [6],



*


Tel: 0989 516346; Email: ptnhansptn@gmail.com


[7]. Phân họ gen DREB có 10 thành viên
được xác định trong hệ gen cây đậu tương
(GmDREBa, GmDREBb, GmDREBc,



GmDREB1, GmDREB2, GmDREB3,


GmDREB5, GmDREB6, GmDREB7) [10].


Mỗi gen trong họ DREB có trình tự, độ dài
khác nhau nhưng đều được biểu hiện nhiều
khi cây gặp hạn. Nhóm DREB1 điều khiển
tính chịu hạn, mặn và lạnh, trong khi nhóm


DREB2 điều khiển tính chịu hạn.


Phân nhóm DREB2 gồm 8 thành viên trong cây


Arabidopsis [11] và 5 thành viên trong lúa gạo


[8]. Chen và cộng sự (2007) [6] đã phân lập
gen GmDREB2 từ đậu tương và dựa trên sự
giống nhau về miền AP2, gen GmDREB2 xếp
vào phân họ A-5 trong phân họ DREB. Sự biểu
hiện của GmDREB2 ở cây thuốc lá chuyển gen
thể hiện ở sự tích lũy hàm lượng proline cao.
Sản phẩm biểu hiện của gen GmDREB2 được
tìm thấy khi cây đậu tương gặp hạn, lạnh và
mặn [6], [8]. Bài báo này trình bày kết quả
chuyển cấu trúc mang gen GmDREB2 vào
giống đậu tương ĐT12 phục vụ tạo dòng cây
đậu tương chuyển gen chịu hạn.


VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU



Vật liệu và hóa chất



(2)

Chủng A. tumefaciens chứa cấu trúc pBI121-GmDREB2 do Bộ môn Sinh học hiện đại & Giáo
dục sinh học, Khoa Sinh học, trường Đại học Sư phạm – Đại học Thái Nguyên cung cấp. Cấu
trúc vector chuyển gen được trình bày ở hình 1.


Hình 1. Sơ đồ cấu trúc vector chuyển gen pBI121 mang gen GmDREB2 (pBI121-GmDREB2). (LB: Bờ trái
của T-DNA; RB: Bờ phải của T-DNA; KanR: trình tự kháng kanamycin; 35S: Promoter 35S; GmDREB2:
Trình tự gen GmDREB2; Cmyc: Trình tự nucleotide mã hóa kháng nguyên Cmyc; NOS (Nos ter): Nopaline


synthase terminator (đoạn kết thúc)


Các hóa chất được sản xuất bởi các hãng
Fermentas, Invitrogen, Merck, Sigma,
Amersham Pharmacia Biotech, như: Yeast
extract, trypton, tris HCl, EDTA, glycerol,
kanamycin, rifamicine, cefotaxime...


Các thiết bị chính dùng trong nghiên cứu gồm
có: Máy PCR System 9700 (Appied
Biosystem, Mỹ), máy điện di Powerpac300
(Bio-Rad, Mỹ), máy xung điện Gen Plulser...


Phương pháp nghiên cứu


Phương pháp chuyển gen thông qua nách lá
mầm nhờ A.tumefaciens được tiến hành dựa


trên nghiên cứu của Olhoft và cộng sự (2006)
[9] và Nguyễn Thị Thúy Hường (2011) [2].


Các thí nghiệm được thực hiện trong phòng
nuôi cấy với điều kiện chiếu sáng theo quang
chu kì 16 giờ sáng và 8 giờ tối, nhiệt độ phòng
25oC ± 2, cường độ chiếu sáng 2000 lux.


Phương pháp tách chiết DNA tổng số từ các


mẫu lá non được thực hiện theo phương pháp
của Saghai Maroof và cộng sự (1984) [12].


Phương pháp PCR xác định sự có mặt của


gen chuyển GmDREB2 bằng cặp mồi


GmDREB2-BamHI/Cmyc-SacI (sản phẩm dự


kiến có kích thước 543 bp), và vector


pBI121-GmDREB2 bằng cặp mồi 35S-F/35S-R (sản


phẩm dự kiến có kích thước 314 bp) trong cây
đậu tương chuyển gen ở thế hệ T0. Trình tự
nucleotide của cặp mồi


GmDREB2-BamHI/Cmyc-SacI và 35S-F/35S-R như sau:


GmDREB2-BamHI: 5’ –


CGGATCCGATGGAAGAAGCGGGTTTA
GG – 3’



GmDREB2-Cmyc-SacI: 5’ –


CGAGCTCGTCAATTCAGATCCTCTTCTG


35S-F: 5’ –


CACGACACACTTGTCTAC – 3’


35S-R: 5’ –


TCACATCAATCCACTTGCT – 3’


Phản ứng PCR được thực hiện theo chu trình
nhiệt: 94oC trong 3 phút; (94oC trong 1 phút;
56oC trong 1 phút; 72oC trong 1 phút) lặp lại 30
chu kỳ; 72oC trong 10 phút; bảo quản ở 4oC.

KẾT QUẢ VÀ THẢO LUẬN



Lây nhiễm và tái sinh cây đậu tương
chuyển gen


Hạt đậu tương nảy mầm trên môi trường GM,
sau khoảng 5 ngày, kích thước mầm đạt
khoảng 5 cm và lá mầm xanh (Hình 2A). Các
mảnh lá mầm được thu, gây tổn thương ở
nách lá mầm để sử dụng làm mẫu biến nạp
(Hình 2B). Lá mầm đã gây tổn thương được
ngâm trong dịch huyền phù chứa



A.tumefaciens mang cấu trúc chứa gen


GmDREB2 có OD600 đạt 0,8 trong thời gian


30 phút (Hình 2C). Sau thời gian nhiễm
khuẩn, mẫu được chuyển sang môi trường
đồng ni cấy CCM ở 25o


C trong tối 5 ngày
(Hình 2D).



(3)

A B


C D


Nách lá mầm


Hình 2. Hình ảnh gây tổn thương nách lá mầm và
biến nạp. A: Hạt đậu tương ĐT12 nảy mầm trên
môi trường GM; B: Gây tổn thương nách lá mầm;
C: Mảnh lá mầm được nhiễm khuẩn; D: Mẫu biến
nạp chuyển sang mơi trường đồng ni cấy CCM


A B


C D


Hình 3. Hình ảnh đa chồi và kéo dài chồi. A:
Cảm ứng tạo đa chồi trên SIM bổ sung BAP 2
mg/l và kanamycine trong 1 tuần; B: Cảm ứng


tạo đa chồi trên SIM bổ sung BAP 2 mg/l và
kanamycine trong 2 tuần; C: Kéo dài chồi SEM


(bổ sung GA3 0,5 mg/l + IAA 0,1 mg/l +
kanamycine 50 mg/l) trong 1 tuần; D: Kéo dài
chồi SEM (bổ sung GA3 0,5 mg/l + IAA 0,1 mg/l


+ kanamycine 50 mg/l) trong 2 tuần


Hình 4. Giai đoạn ra rễ và trồng cây đậu tương
chuyển gen ĐT12 trên giá thể


Khi các chồi phát triển đạt kích thước từ 3 - 5
cm sẽ được chuyển sang môi trường ra rễ
(RM) có bổ sung cefotaxim 250 mg/l để tạo
cây hồn chỉnh (Hình 4).


Thí nghiệm biến nạp cấu trúc chứa gen


GmDREB2 qua nách lá mầm nhờ


A.tumefaciens được thực hiện lặp lại 3 lần.


Kết quả thí nghiệm chuyển gen và đối chứng
được trình bày ở bảng 1. Trong 300 mẫu được
biến nạp cấu trúc chứa gen GmDREB2, 203
mẫu tạo được đa chồi, trong đó có 393 chồi
sống sót, 197 chồi được kéo dài. Số chồi ra rễ
là 60, số cây được trồng trên giá thể là 20 cây
và có 5 cây sống sót. Đối với lơ đối chứng


ĐC0, với 30 mẫu biến nạp và kết quả khơng
có chồi nào được tạo thành, vì thế cũng khơng
có chồi được kéo dài, ra rễ và ra giá thể. Đối
với lô đối chứng ĐC1, 20 mẫu được tạo đa
chồi, 35 chồi sống sót, 20 chồi được kéo dài
và 15 chồi được chuyển vào môi trường ra rễ.
Số cây được đưa ra giá thể là 15 cây, trong đó
có 10 cây sống sót. Như vậy ở giai đoạn tái sinh
và chọn lọc in vitro, chúng tôi thu được 5 cây
đậu tương được chuyển gen ở thế hệ T0 (ký
hiệu là 01, 02, 03,
ĐT12-04, ĐT12-05). Hiệu suất chuyển gen ở giai đoạn
chọn lọc bằng kháng sinh là 1,67% (5/300).
Cũng theo phương pháp chuyển gen này, Lò
Thị Mai Thu (2014) [4] chuyển cấu trúc CPi
(SMV- BYMV) vào hai giống đậu tương
ĐT12 và DT2008 có hiệu suất lần lượt là
4,32% và 3,76%; Lò Thanh Sơn (2015) [3]
chuyển cấu trúc mang gen GmEXP1 vào
giống đậu tương DT84 với hiệu suất 2,37%;
Nguyễn Thu Hiền (2011) [1] chuyển gen HA1
vào giống đậu tương ĐT12 với hiệu suất
2,37%; Nguyễn Thúy Hường (2011) [2] chuyển
gen vào giống đậu tương DT84 với hiệu suất là
2,22%. Như vậy, hiệu suất chuyển gen ở giai
đoạn này của chúng tôi thấp hơn hiệu suất
chuyển gen của các tác giả trước.


Lá non của cây đậu tương không chuyển gen
và 5 cây đậu tương chuyển gen sống sót trên


giá thể ở thế hệ T0 được thu nhận để tách
chiết DNA tổng số, kiểm tra sự có mặt của
cấu trúc mang gen chuyển



(4)

Bảng 1. Kết quả biến nạp gen GmDREB2 vào giống đậu tương ĐT12
Lơ đối chứng và


thí nghiệm biến nạp Số mẫu Số mẫu tạo đa chồi sống sót Số chồi Số chồi kéo dài


Số chồi


ra rễ Số cây trồng trên giá thể sống sót Số cây


ĐC0 30 0 0 0 0 0 0


ĐC1 30 20 35 20 15 15 10


1 100 68 136 67 20 7 1


2 100 55 109 45 15 5 2


3 100 80 148 85 25 8 2


Tổng số (1+2+3) 300 203 393 197 60 20 5


Ghi chú: ĐC0*: Lá mầm đậu tương không chuyển gen được cấy trên mơi trường tái sinh có bổ sung kháng sinh;
ĐC1*: Lá mầm đậu tương không chuyển gen được cấy trên môi trường tái sinh không bổ sung kháng sinh.


Phân tích sự có mặt của gen chuyển GmDREB2 trong cây đậu tương chuyển gen thế hệ T0



PCR là phương pháp nhanh, chính xác để đánh giá cây chuyển gen. Do vậy, chúng tôi tiến hành
phản ứng PCR với cặp mồi 35S-F/35S-R để kiểm tra sự có mặt của promoter 35S trong cấu trúc
vector pBI121- GmDREB2 ở cây đậu tương chuyển gen. Sản phẩm của phản ứng có kích thước
theo dự tính 314 bp (Hình 5A).


(A) (B)


Hình 5. Kết quả điện di sản phẩm PCR xác định sự có mặt của đoạn promoter 35S (A) và gen chuyển
GmDREB2 (B) trong các cây đậu tương chuyển gen ở thế hệ T0. M: Thang DNA 1kb; 1, 2, 3, 4, 5: Sản phẩm


PCR các cây chuyển gen ĐT12-01, ĐT12-02, ĐT12-03, ĐT12-04, ĐT12-05; (+): Sản phẩm PCR từ vector
pBI121-GmDREB2; (-): Sản phẩm PCR của cây khơng chuyển gen.


Hình 5A cho thấy, băng DNA có kích thước
khoảng 0,3 kb xuất hiện ở đối chứng dương
(+) và bốn cây chuyển gen, trong khi đối
chứng âm (-) khơng có. Như vậy, cấu trúc
pBI121-GmDREB2 đã có mặt ở 4 cây chuyển
gen ĐT12-01, ĐT12-03, ĐT12-04, ĐT12-05
ở thế hệ T0.


Kết quả kiểm tra sản phẩm của phản ứng PCR
nhân gen GmDREB2 ở hình 5B cho thấy đối
chứng dương và các cây chuyển gen
ĐT12-01, ĐT12-03, ĐT12-04, ĐT12-05 tồn tại băng
DNA có kích thước khoảng 0,55 kb. Theo
tính tốn lý thuyết, đoạn gen GmDREB2 được
nhân bản dài 498 bp, đoạn Cmyc và KDEL
dài 45 bp và dự tính sản phẩm của PCR với



cặp mồi


GmDREB2-BamHI/GmDREB2-Cmyc-SacI sẽ nhân bản được đoạn DNA có


kích thước là 543 bp. Như vậy, kết quả PCR
thu được đoạn DNA có kích thước phù hợp
với tính tốn lý thuyết, là cơ sở để nhận xét


thành công vào giống đậu tương ĐT12. Cả
hai thí nghiệm sử dụng kỹ thuật PCR nhân
bản đoạn promoter 35S và gen GmDREB2
đều cho kết quả dương tính ở 4 cây đậu tương
chuyển gen ĐT12-01, ĐT12-03, ĐT12-04,
ĐT12-05 ở thế hệ T0. Như vậy, hiệu suất
chuyển gen ở giai đoạn kiểm tra gen chuyển
bằng PCR là 4/300 (hay 1,33%). Trong kết
quả nghiên cứu của Lò Thị Mai Thu (2014)
[4], hiệu suất chuyển gen đạt 1,35% (với
giống ĐT12), 2,24% (với giống DT2008);
của Lò Thanh Sơn (2015) [3], hiệu suất
chuyển gen đạt 0,27%; của Nguyễn Thu
Hiền (2011) [1], hiệu suất là 1,23%; của
Nguyễn Thị Thúy Hường (2011) [2], hiệu
suất chuyển gen đạt 0,23%.



(5)

KẾT LUẬN



Cấu trúc pBI121-GmDREB2 đã được biến
nạp thành công vào giống đậu tương ĐT12 qua
nách lá mầm thông qua chủng A. tumefaciens.


Các mẫu biến nạp được tái sinh in vitro, chọn
lọc bằng kháng sinh và tạo cây đậu tương
chuyển gen. Kết quả có 203/300 mẫu biến
nạp tạo đa chồi, 393 chồi sống sót, có 197
chồi chọn lọc trong môi trường kéo dài chồi
và số chồi được cho ra rễ là 60. Số cây
chuyển gen trồng trên giá thể là 20 cây và có
5 cây sống sót ở điều kiện nhà lưới, hiệu suất
chuyển gen ở giai đoạn này là 1,67% (5/300).
Phân tích sự có mặt của gen chuyển


GmDREB2 trong 5 dòng cây ở thế hệ T0 thu


được 4 cây chuyển gen dương tính với PCR,
hiệu suất chuyển gen đạt 1,33% (4/300).


LỜI CẢM ƠN: Nghiên cứu này được hỗ trợ
và trong khuôn khổ của Đề tài cấp Bộ Giáo
dục & Đào tạo, mã số B2017-TNA-38 do
GS.TS Chu Hoàng Mậu làm chủ nhiệm.


TÀI LIỆU THAM KHẢO


1. Nguyễn Thu Hiền (2011), Nghiên cứu chuyển
gen mã hóa protein bề mặt của virus H5N1 vào
cây đậu tương phục vụ sản xuất vaccine thực vật,
Luận án tiến sĩ Sinh học, Đại học Thái Nguyên.
2. Nguyễn Thị Thuý Hường (2011), Phân lập,
tạo đột biến điểm ở gen P5CS liên quan đến tính
chịu hạn và thử nghiệm chuyển vào cây đậu


tương Việt Nam, Luận án tiến sĩ Sinh học, Đại
học Thái Nguyên.


3. Lò Thanh Sơn (2015), Nghiên cứu đặc điểm và
chuyển gen GmEXP1 liên quan đến sự phát triển
bộ rễ của cây đậu tương, Luận án tiến sĩ Sinh học,
Đại học Thái Nguyên.


4. Lò Thị Mai Thu (2014), Phân lập đoạn gen CP
từ Soybean mosaic virus và phát triển vector
chuyển gen mang cấu trúc RNAi phục vụ tạo cây


đậu tương chuyển gen kháng bệnh, Luận án tiến sĩ
Sinh học, Đại học Thái Nguyên.


5. Chen F., Chen S. Y. and Liu Q. (2002),
“Isolation of a rice cDNA encoding a DREB-like
protein induced by stresses”, GenBank, Accession
AY064403.


6. Chen M., Wang Q. Y., Xu Z. S., Li L. C., Ye X.
G., Xia L. Q., Ma Y. Z. (2007), “GmDREB2, a
soybean DRE – binding transcription factor,
conferred droungt anh high – salt tolerance in
transgenic plants”, Biochem. Biophys. Res.
Commun., 353(2), pp. 299 – 305.


7. Huang B., Jin L. and Liu J. (2007), “Molecular
cloning and functional characterization of a
DREB1/CBF-like gene (GhDREB1L) from


cotton”, Sci. China Life Sci., 50 (1), pp. 7-14.
8. Matsukura S., Mizoi J., Yoshida T., Todaka D.,
Ito Y., Maruyama K., Shinozaki K.,
Yamaguchi-Shinozaki K. (2010), “Comprehensive analysis of
rice DREB2-type genes that encode transcription
factors involved in the expression of abiotic
stress-responsive genes”, Mol. Genet. Genomics, 283,
pp. 185–196.


9. Olhoft P. M., Somers D. A. (2001), “L-Cysteine
increases Agrobacteriummediated T-DNA
delivery into soybean cotyledonarynode cells”,
Plant Cell Rep., 20, pp. 706-711.


10. Ratcliffe O. J., Riechmann J. L. (2002),
“Arabidopsis transcription factors and the regulation
of flowering time: a genomic perspective”, Curr.
Issues Mol. Biol., 4, pp. 77–91.


11. Riechmann J. L., Heard J., Martin G., Reuber
L., Jiang C. Z., Keddie J., Adam L., Pineda O.,
Ratcliffe O. J., Samaha R. R., Crelman R., Pilgrim
M., Broun P., Zhang J. Z., Ghandehari D.,
Sherman B. K., Yu G. L. (2000), “Arabidopsis
transcription factors: Genome-wide comparative
analysis among eukaryotes”, Science, 290, pp.
2105–2110.



(6)

SUMMARY



STUDYING ON TRANSFERRING A CONSTRUCTION CONTAINING
GmDREB2 GENE INTO ĐT12 SOYBEAN CULTIVAR


Pham Thi Thanh Nhan*, Pham Minh Hao,
Nguyen Thi Ngoc Lan, Chu Hoang Mau


TNU - University of Education


Soybean (Glycine max (L.) Merrill) is one of the most important crop plants with a high economic
value. However, this is also the plant sensitive to different stresses in the environment and has the
low drought ability. Their property is a multigene trait whose products directly involve in the drought
tolerance or regulate the expression of resistant genes. The GmDREB2 gene in soybean plant is
considered as a necessary factor to activate the transcription of resistant genes in drought, cold and
salt conditions. This paper presents the results of studying on transformation a construction
containing GmDREB2 gene into ĐT12 soybean cultivar in order to produce transgenic soybean
plants with high drought resistant ability. The structure pBI121-GmDREB2 was successfully
transferred into ĐT12 soybean cultivar by Agrobacterium tumefaciens-mediated transformation via
cotyledonary axillary nodes. All infected samples were regenerated in vitro and selected by
antibiotic to creat the transgenic soybean plants. Consequently, from 300 samples, 203 shoots were
induced on shoot elongation medium supplemented with kanamycin, in which 197 shoots were
prolonged and 60 elongated shoots were rooted. All 20 rooted plantlets were planted on the pots,
among which 5 plantlets survived in the greenhouse condition at the T0 generation, thus, the
transgenic efficiency at this stage was 1.67% (5/300). From them, there were four transgenic soybean
plantlets with the possitive PCR results, the transgenic efficiency at this stage was 1.33% (4/300).


Keywords: Drought, Glycine max (L.) Merrill, GmDREB2, A. tumefaciens, transgenic efficiency






×