Tải bản đầy đủ

CHUYÊN đề hệ THỐNG lý THUYẾT và bài tập về CÔNG NGHỆ ADN

HỆ THỐNG LÝ THUYẾT VÀ BÀI TẬP VỀ CÔNG NGHỆ ADN
PHẦN I – MỞ ĐẦU
I. LÍ DO CHỌN ĐỀ TÀI
Dựa trên hai nền tảng cơ bản là hóa sinh học và di truyền học, cùng với sự phát triển
nhanh chóng của công nghệ hiện đại, sinh học phân tử ra đời tác động toàn diện đến nhiều
ngành khoa học và đời sống con người. Trong nghiên cứu sinh học phân tử, thực nghiệm
thao tác với ADN mà cơ bản là công nghệ ADN tái tổ hợp giữa vai trò then chốt. Trong các
kì thi học sinh giỏi Quốc gia và các câu hỏi thi Olympic học các nước, Olympic Sinh học
quốc tế thì những nội dung kiến thức của liên quan đến công nghệ ADN tái tổ hợp đóng vai
trò quan trọng và là một trong các kiến thức quan trọng trong các đề thi.
Với mục đích chuẩn bị nội dung dạy ôn tập phần ứng dụng di truyền học cho Đội
Tuyển thi HSG Sinh học Quốc gia cũng như để trau dồi kiến thức cho bản thân cũng như để
thảo luận kiến thức về ứng dụng di truyền học với các đồng nghiệp tôi thực hiện viết chuyên
đề “Hệ thống hóa kiến thức và tập bài tập vông nghệ ADN”
Như mục đích đã nói ban đầu, là chuẩn bị nội dung cho dạy ôn Đội tuyển Sinh học
thi HSG Quốc gia, nên tôi không chỉ giới thiệu kiến thức lý thuyết mà tôi hệ thống các kiến
thức lý thuyết liên quan đến công nghệ ADN dưới dạng các câu hỏi và mỗi câu hỏi đều có
hướng dẫn trả lời cụ thể. Đồng thời tôi cũng sưu tầm bài tập vầ công nghệ ADN. Tôi hiệu hy
vọng chuyên đề này là tài hữu ích cho tôi, cho các bạn đồng nghiệp và cho các em học sinh
yêu thích môn Sinh học.
II. MỤC ĐÍCH CỦA ĐỀ TÀI

- Hệ thống hóa kiến thức về công nghệ ADN tái tổ hợp dưới dạng các câu hỏi và có hướng
dẫn trả lời.
- Xây dựng hệ thống các bài tập liên quan đến công nghệ ADN tái tổ hợp và các kĩ thuật di
truyền hiện đại để vừa củng cố kiến thức lí thuyết vừa rèn luyện kĩ năng trả lời câu hỏi bài
tập học sinh.
PHẦN II – NỘI DUNG
A. HỆ THỐNG KIẾN THỨC TRỌNG TÂM
I. Nhân dòng ADN
Câu 1: Thế nào là nhân dòng gen? Để nhân dòng gen cần những thao tác nào? Mục
đích của nhân dòng gen là gì?
- Quá trình tạo ra nhiều bản sao của một gen gọi là nhân dòng gen
- Để nhân dòng gen trong phòng thí nghiệm cần những thao tác sau đây:


+ Phân lập plasmit từ vi khuẩn.
+ Cài vào đó gen cần nhân dòng. Plasmit lúc này chứa phân từ ADN tái tổ hợp.
+ Plasmit chứa phân từ ADN tái tổ hợp được đưa trở lại tế bào vi khuẩn tạo nên một vi
khuẩn tái tổ hợp.
+ Tế bào vi khuẩn tái tổ hợp được cho sinh sản qua nhiều lần phân bào. Nhờ thu được một
lượng lớn ADN tái tổ hợp.
- Nhân dòng gen nhằm hai mục đích: để tạo ra nhiều bản sao của một gen đặc thù và để tạo
ra một sản phẩm protein
Câu 2: Một trong những công cụ không thể thiếu của công nghệ gen là enzim giới hạn.
Thế nào là enzim giới hạn? Enzim giới hạn cần có những đặc tính nào? Nêu các ứng
dụng của enzim giới hạn?
- Enzim giới hạn là các enzim có thể nhận ra một trình tự ADN ngắn nhất định, được gọi là
vị trí giới hạn, và cắt cả hai mạch tại một điểm chính xác tại vị trí giới hạn.
- Các enzim giới hạn cần có hai đặc tính:
+ Nhận biết một trình tự đặc hiệu trên ADN gọi là vị trí giới hạn.
+ Cắt trong phân tử ADN tại vị trí đặc hiệu.
- Các ứng dụng của enzim giới hạn:
+ Là công cụ không thể thiếu của công nghệ gen để tạo AND tái tổ hợp.
+ Sử dụng trong phân tích ADN: Hầu hết các ADN trong tự nhiên có kích thước rất lớn,
chứa hàng trăm hoặc hang ngàn gen. Vì vậy để phân lập và phân tích từng gen, người ta
phải cắt các phân tử ADN kích thước lớn thành các đoạn nhỏ. Công việc này thực được hiện
nhờ enzim giới hạn.
+ Sử dụng nzim giới hạn kết hợp với diện di giúp so sánh hai phân tử ADN từ đó xác định
vị trí xảy ra đột biến.
Câu 3: Các enzim giới hạn gồm những loại nào? Các enzim giới hạn được phân lập
trong các tế bào vi khuẩn. Nêu ý nghĩa của sự tồn tại của các enzim này và tại sao các


ADN của các tế bào vi khuẩn đó không bị cắt bởi các enzim cắt giới hạn đó.
- Dựa vào trình tự nhận biết, vị trí cắt, và cofactor được yêu cầu, người ta chia enzim giới
hạn thành bốn loại như bảng sau đây:
Loại Enzyme
Kiểu I
Kiểu II

Đặc tính
- Dạng protein đa tiểu phần với cả hai hoạt tính cắt giới hạn và methyl hóa
- Yêu cầu ATP
- Vị trí cắt thì có một khoảng cách khác nhau từ vị trí nhận biết
- Trình tự nhận biết đặc hiệu
- Vị trí cắt trong hoặc gần với trình tự nhận biết
- Tạo đầu 5′ phosphate và đầu 3′ hydroxyl ở vị trí cắt
- Yêu cầu Mg2+ cho hầu hết các trường hợp

Kiểu III

- Trình tự nhận biết hai phần theo hướng ngược chiều
- Vị trí cắt có một khoảng cách đặc hiệu với một trình tự nhận biết
- Yêu cầu ATP

Kiểu IV

- Chỉ cắt trình tự ADN bị methyl hóa


- Vị trí cắt cách khoảng 30 bp tính từ vị trí nhận biết
Trong bốn loại trên, loại dung phổ biến nhất là loại II vì trình tự cắt ADN tại vị trí đặc hiệu ngay
tại vị trí giới hạn, còn các loại khác cắt ADN cách vị trí giới hạn một số nucleotit xác định.
Các vị trí cắt của enzim nhóm II này thường gồm 4-8 bp, thường có tính đối xứng và điểm
cắt trong trình tự giới hạn.
Ví dụ:
EcoRI: có trình tự cắt giới hạn là 5’-G↓AATTC-3’
HindIII có trình tự cắt giới hạn là 5’-A↓AGCTT-3’
Sau3AI có trình tự cắt giới hạn là 5’-GA↓TC-3’
NotI có trình tự cắt giới hạn là 5’-GC↓GGCCGC-3’
- Các enzim giới hạn không chỉ khác nhau về trình tự giới hạn mà còn khác nhau về cách cắt
phân tử ADN.
+ Cắt đầu tù (cắt đầu bằng): ví dụ enzim Sau3AI.
+ Cắt đầu dính: ví dụ các enzim: EcoRI, HindIII, NotI.
Các enzim cắt đầu dính được ưu tiên sử dụng trong tạo ADN tái tổ hợp hơn vì khi trộn các
đoạn ADN, các đoạn đầu dính bắt cặp với nhau theo nguyên lí của Chargaff.
- Các enzim giới hạn được phân lập trong các tế bào vi khuẩn. Sở dĩ các tế bào vi khuẩn có
các enzim giới hạn là để chống lại sự lây nhiễm các phage hoặc các ADN ngoại lai. Trong tế
bào vi khuẩn, trên ADN của nó có các trình tự giới hạn nhưng các adenine và cytosine tại
các trình tự nhận biết được metyl hóa nên tránh khỏi sự nhận biết của các enzim giới hạn.
Câu 4: Để nhân dòng gen, người ta có thể sử dụng các loại vector nào, ưu điểm của của
các vector nhân dòng đó là gì?
- Sử dụng plasmit làm vector nhân dòng: các plasmit của vi khuẩn thường được sử dụng làm
vector nhân dòng vì các nguyên nhân sau đây:
+ Chúng dẽ dàng phân lập từ tế bào vi khuẩn, dê thao tác để tạo ADN tái tổ hợp bằng việc
cài vào đó một đoạn ADN ngoại lai và được đưa trở lại tế bào vi khuẩn.
+ Chúng có thể nhân lên độc lập với sự nhân lên của ADN tế bào chủ do các plasmit có các
trình tự khởi đầu tái bản độc lập với trình tự khởi đầu tái bản của ADN vùng nhân.
+ Các plasmit vi khuẩn mang ADN tái tổ hợp có thể nhân lên nhanh chóng nhờ tốc độ sinh
sản cao của tế bào chủ.
+ Mỗi dòng plamit có thể có nhiều trình tự nhận biết của enzim giới hạn nên có thể gắn vào
đó nhiều gen khác nhau.
- Sử dụng thực khuẩn thể làm vector chuyển gen: Các đoạn ADN ngoại lai có thể nối vào hệ
gen của phage sau khi nó được cắt tỉa bớt những gen không quan trọng đối với phage, giống
như ghép vào plasmit nhờ một enzim giới hạn và một ADN ligase. Quá trình lây nhiễm bình
thường cho phép sản sinh ra các hạt virut mới, mỗi loại mang một đoạn ADN ngoại lai.
Một ưu điểm khác nữa của việc sử dụng phage là có thể mang các đoạn cài có kích thước lớn
hơn (25kb) trong khi một plasmit vi khuẩn chỉ có thể mang đoạn cài kích thước nhỏ hơn 12kb.


- Sử dụng nhiễm sắc thể nhân tạo của vi khuẩn (BAC) làm vector chuyển gen: Là các
plasmit được cắt tỉa bớt sao cho chỉ còn những gen thiết yếu làm giảm kích thước của vector
nhờ đó có thể cài vào đó đoạn ADN kích thước lớn hơn (200-300kb). Trong thư viện gen,
việc sử dụng các nhiễm sắc thể nhân tạo của vi khuẩn giúp giảm thiểu tối đa các dòng tế bào
cần có trong thư viện hên gen.
- Sử dụng nhiễm sắc thể nhân tạo của nấm men (YAC) làm công cụ nhân dòng gen YAC kết
hợp các trình tự thiết yếu của một NST sinh vật nhân thực tách ra từ nấm men (một trình tự
khởi đầu tái bản, một tâm động và hai đầu mút) cùng với đoạn cài là đoạn ADN ngoại lai.
Các YAC hoạt động như một NST trong nguyên phân và có thể mang một đoạn ADN dài
hơn rất nhiều so với plasmit đồng thời có trình tự điều hòa hoạt động cho các gen của sinh
vật nhân thực và có thể có những biến đổi phù hợp sau dịch mã như gắn thêm các nhóm lipit
hoặc cacbohydrat, điều này không thể xảy ra ở các tế bào vi khuẩn.
Câu 5: Sử dụng vector đê nhân dòng gen trong tế bào, tuy nhiên hiện nay người ta còn
sử dụng nhân dòng gen trong ống nghiệm: Phản ứng chuỗi trùng hợp (PCR). Nêu ưu
điểm và nhược điểm của PCR và giải thích tại sao PRC có nhiều ứng dụng rộng rãi
nhưng không thể thay thế được nhân dòng gen bằng vector?
- Nhân dòng ADN trong tế bào vẫn là phương pháp tốt nhất để chuẩn bị một số lượng lớn
của một gen hay một trình tự ADN nhất định nào đó. Tuy nhiên trong một số trường hợp
nghười ta phải sửu dụng phản ứng chuỗi trùng hợp vì các lí do sau đây:
+ Khi nguồi ADN không đủ hoặc bị pha tạp, người ta bắt buộc pahir sử dụng phản ứng PCR
để nhân dòng các gen là kĩ thuật nhanh và có tính đặc hiệu cao hơn trước khi các đoạn ADN
được cài vào vector.
+ Phản ứng PCR cho phép tạo ra số lượng lớn bản sao trong một khoảng thời gian ngắn một
cách dễ dàng.
+ Với tính đặc hiệu và tốc độ nhanh, chỉ cần một lượng rất nhỏ có trong vật liệu khởi đầu là
có thể nhân dòng ngay cả khi ADN đã bị phân hủy một phần, miễn chỉ cần có một vài phân
tử còn chứa trình tự đích nguyên vẹn.
- Mặc dù có ưu thế về tốc độ và tính đặc hiệu, song PCR vẫn không thể thay thế được việc
nhân dòng gen nhờ các tế bào mỗi khi một gen nào đó cần với số lượng lớn, nguyên nhân
là:
+ Trong phản ứng PCR, do không có các en zim sửa sai nên lỗi sao chép đôi khi hay xảy ra,
chính vì vậy, khi PCR dùng để cung cấp những đoạn ADN cho nhân dòng gen thì các dòng
thu được sẽ được giải trình tự để chọn dòng tế bào mang đoạn cài không chứa lỗi.
+ Khi mục tiêu không đơn thuần là nhân dòng gen mà là sản phẩm protein thì bắt buộc phải
nhân dòng gen trong tế bào nhờ các vector.
II. Các ứng dụng của công nghệ gen- công nghệ ADN trong nghiên cứu
1. Công nghệ ADN cho phép nghiên cứu trình tự, sự biểu hiện và chức năng của gen
Câu 1: Các kỹ thuật để xác định trình tự của gen? Hãy giải thích cơ sở và ứng dụng
của các kỹ thuật này?
a. Điện di gel và thẩm tách Southern
- Cơ sở: Do các phân tử axit nucleic mang điện âm trên các gốc phosphate p chúng nên
chúng luôn di chuyển về cực âm của điện trường. Khi chúng di chuyển, các sợi polimer của
gel ngăn cản mạng hơn đối với các sợi ADN dài hơn. Do đó điện di trên gel giúp phân tách


các phân tử ADN mạch thẳng thành các băng điện di, trong đó mỗi băng sẽ bao gồm các
phân tử có chiều dài giống nhau.
- Ứng dụng:
+ Dùng để phân tích các đoạn giới hạn, chúng có thể nhanh chóng cung cấp thong tin về
trình tự ADN: Trong kiểu phân tích này, người ta cắt cac phân tử ADN bằng enzim giới hạn,
sau đó các đoạn ADN được phân tách trên gel điện di, nó tạo nên một kiểu bang đặc trưng
cho phân tử ADN gốc ban đầu được cắt bởi loại enzim giới hạn nhất định.
+ Dùng để chuẩn bị mẫu tinh sạch chứa các đoạn ADN riêng biệt nếu như bang ADN quan tâm
có thể phân tách rõ ràng khỏi các băng còn lại do có thể thu hồi ADN nguyên vẹn từ gel điện di.
+ Dùng để so sánh hai phân tử ADN khác nhau chẳng hạn như hai alen của một gen. Một
enzim giới hạn nhận ra một trình tự nucleotit đặc thù, thậm chí chỉ cần thay đổi một
nucleotit trong vị trí giới hạn cũng đủ cho nó không bị cắt bởi một enzim giới hạn, ví dụ:
bệnh hồng cầu hình liểm do một đột biến đơn nucleotit nằm trong trinh tự giới hạn của gen
β-globin. Khi dung. Kết quả là gen bình thường enzim giới hạn là DdeI bị cắt thành một
đoạn lớn, một đoạn 175bp và một đoạn 201bp, còn alen đột biến chỉ bị cắt thành hai đoạn
376bp và đoạn lớn (hình minh họa dưới đây)

+ Nếu vật liệu ban đầu không phải là các alen được tinh sạch ví dụ muốn xác định một
người liệu một người có phải có kiểu gen dị hợp tử về bệnh hồng cầu hình liểm hay không,
người ta sử dụng phương pháp lai Southern trong đó kết hợp giữa điện di và axit nucleic,
cho phép chúng ta xác định các bang điện di mang gen β-globin.
Nguyên lí của phương pháp này giống lai nucleic để sàng lọc tìm ra các chủng vi khuẩn.
Trong phương pháp này, mẫu dò là thường là một đoạn phân tử ADN mạch đơn đánh dấu
phóng xạ có trình tự bổ sung với các gen được quan tâm.
b. Giải trình tự AND bằng phương pháp kết thúc chuỗi dideoxy
- Cơ sở: Phương pháp này tổng hợp trên một tập hợp các mạch ADN có trình tự bổ sung với
các đoạn AND gốc. Mỗi mạch được bắt đầu từ một số mồi giống nhau và kết thúc bởi một
dideoxynucleotit (ddNTP), một nucleotit được biến đổi. Sự lắp ráp của ddNTP làm dừng
quá trình kéo dài mạch ADN vì nó thiếu 3’OH là vị trí đề nucleotit phía sau gắn vào. Trong
tập hợp các mạch AND được tổng hợp, mỗi một vị trí nucleotit đọc theo trình tự gốc được
thể hiện qua các mạch được kết thúc tại vị trí đó nhờ một ddNTP. Nhờ môĩ loại ddNTP được
gắn vào một gốc huỳnh quang khác nhau, nên dễ dàng xác định được nucleotit kết thúc ở
mỗi mạch được tổng hợp mới, từ đó suy ra toàn bộ trình tự của mạch gốc.


- Ứng dụng: Giải trình tự gen cho phép các nhà nghiên cứu so sánh trực tiếp gen đó với các
gen khác đã biết về chức năng từ đó có thể tìm hiểu chức năng của một gen nào đó.
2. Công nghệ ADN phân tích sự biểu hiện gen
Câu 2: Giả sử đã nhân dòng được một gen nào đó, muốn tìm hiểu gen đó thay đổi như
thế nào trong quá trình phát triển phôi của động vật, người ta có thể sử dụng phương
pháp thẩm tách Northern hoặc phản ứng chuổi trùng hợp phiên mã ngược (RT-PRC)
hoăc sử dụng phương pháp lai in situ. Hãy phân biệt các phương pháp này?
- Phương pháp thẩm tách Northern dựa trên tiến hành điện di các mẫu mARN tổng số tách
chiết từ phôi động vật ở các giai đoạn khác nhau trong quá trình phát triển rồi chuyển đến
màng nitrocellulose và cho các phân từ trên màng lai với một mẫu dò đánh dấu nhận biết
đặc hiệu mARN của gen đó, sau đó chụp ảnh huỳnh quang. Nếu bang mARN được tìm thấy
ở một giai đoanh phát triển nhất định, thì có thể giả thiết rằng protein của gen biểu hiện
chức năng trong các sự kiện diễn ra trong giai đoạn đó.
- Phương pháp phản ứng chuỗi trùng hợp phiên mã ngược (RT-PRC): Việc phân tích biểu
hiện của gen đã nhân dòng bằng phương pháp RT-PCR cũng bắt đầu từ tách chiết mARN
tổng số sau đó sử dụng enzim phiên mã ngược để tổng hợp cADN, phân tử này dung làm
khuôn cho phản ứng PCR bằng việc dùng cặp mồi đăc hiệu với gen đã được nhân dòng. Khi
sản phẩm của PCR được chạy trên gel điện di, các bản sao của vùng được khuếch đại được
quan sát thấy như các bang, nhưng chúng chỉ có mặt ở các mẫu mà ban đầu có sắn mARN
của gen nhân dòng.
- Phương pháp lai in situ để xác định loiaj mô hay tế bào nào biểu hiện những gen nhất định
trên một cơ thể nguyên vẹn có các phân tử mARN đặc thù, bằng việc tiến hành lai các mẫu
dò đánh dấu tại chỗ. Các mẫu dò khác nhau có thể được đánh dấu bằng các thuốc nhuộm
khác nhau, nhờ đó có thể xác định về khả năng biểu hiện của gen nhân dòng.
3. Ứng dụng công nghệ AND trong xác định chức năng của gen
Câu 3: Hãy trình bày cách để nghiên cứu xác định chức năng của gen?
Để xác định chức năng của một gen đã xác định được, các nhà khoa học làm bất hoạt gen đó
và theo dõi hậu quả trong tế bào và cơ thể. Các nhà khoa học có thể làm bất hoạt gen theo
hai cách sau:
- Cách 1: Sử dụng phương pháp tạo đột biến invitro trên gen nhân dòng, sau đó đưa gen đột
biến trở lại tế bào theo cách làm bất hoạt bản sao bình thường của gen đó trong tế bào. Nếu
đột biến được đưa vào làm thay đổi hoặc làm hỏng chức năng sản phẩm của gen, thì kiểu
hình của tế bào đột biến có thể phản ánh chức năng của protein bình thường đã bị mất.
- Cách 2: Làm bất hoạt sư biểu hiện gen bằng sử dụng ARN can thiệp (ARNi): Sử dụng sợi
kép ARN tổng hợp hóa học có trình tự bắt cặp với một gen nhất định để kích hoạt sự phá
hủy mARN của gen hoặc để ức chế dịch mã.
III. Ứng dụng thực tiễn của công nghệ ADN
Hãy trình bày các ứng dụng của công nghệ ADN trong y học, trong làm sạch môi
trường và trong nông nghiệp?
1. Trong y học
- Công nghệ ADN trong chẩn đoán bệnh
+ Công nghệ ADN dùng trong chẩn đoán các bệnh truyền nhiễm, đặc biệt là dung kỹ thuật
PCR và các mẫu dò axit nucleic để theo dõi các tác nhân gây bệnh.
Ví dụ: Dựa trên sự hiểu rõ trình tự hệ gen của HIV, sử dụng kỹ thuật RT-PCR dung để nhân
bản và phát hiện ARN của HIV trong các mẫu máu hoặc mô sinh phẩm.


+ Chẩn đoán các rối loạn di truyền bằng cách sử dụng phương pháp PCR với các cặp mồi có
gen đích liên quan tới các rối loạn di truyền. Sau đó giải trình tự của các gen để phát hiện có
hay không các đột biến gây bệnh. Bằng phương pháp này có thể chẩn đoán được rối loạn di
truyền trước khi sinh.
- Công nghệ ADN trong liệu pháp gen: Đưa một gen bình thường vào tế bào xô ma của mô
sai hỏng. Thông thường, các tế bào tủy xương thường là các tế bào tiếp nhận liệu pháp gen
vì các tế bào tủy xương là các tế bào có khả năng phân chia.
- Công nghệ ADN trong sản xuất dược phẩm: sản xuất các phân tử nhỏ làm thuốc, sản xuất
các protein đơn bào.
2. Trong làm sạch mô trường
Các nhà khoa học chuyển gen có thể chuyển hóa các hợp chất quan trọng từ một vi khuẩn
sinh sản chậm sang vi khuẩn sinh sản nhanh. Các vi khuẩn chuyển gen này được sử dụng để
xủ lí các vấn đề về môi trường, ví dụ nhiều vi khuẩn có thể chiết xuất được các kim loại
nặng dùng trong công nghiệp khai hoáng đồng thời giúp làm sạch các chất độc hại còn lại
sau hoạt động khai khoáng. Hiện nay, các nhà khoa học đang cố gắng cải biến di truyền của
các vi sinh vật có khả năng phân giải các hợp chất hydrocacbon chứa clo và các hợp chất
gây hại khác.
3. Trong nông nghiệp
- Trong ngành chăn nuôi: công nghệ ADN cho phép tạo ra các động vật chuyển gen giúp
tăng nhanh hiệu quả của công tác chọn, tạo và nhân giống vật nuôi. Ví dụ: các nhag khoa
học có thể xác định và nhân dòng một gen giúp tăng cường phát triển của cơ ở một gia súc
nào đó, rồi chuyển sang một gia súc khác.
- Trong tạo giống ở thực vật:Vector sử dụng phổ biến nhất để chuyển gen vào tế bào thực
vật là Ti plasmit có nguồn gốc từ các sinh vật đất Agrobacterium tumefaciens. Plasmit này
có khả năng kết hợp một phân đoạn của ADN của nó, được gọi là T-ADN, vào ADN nhiễm
sắc thể của tế bào cây chủ.
Kỹ thuật di truyền nhanh chóng thay thế các kĩ thuật chọn, tạo giống truyền thống, đặc biệt
đối với các tính trạng có giá trị cao như kháng sâu bệnh hay kháng thuốc diệt cỏ hoặc những
giống cây trồng có khả năng chống chịu cao.
Kỹ thuật di truyền cón có tiềm năng lớn giúp cải thiện giá trị dinh dưỡng của các loài cây
trồng, ví dụ các nhà khoa học đã thành công trong tạo ra giống lúa “vàng” có khả năng tổng
hợp β-caroten, tiền chất của vitamin A giúp phòng chống thiếu hụt vitamin A gây nên bệnh
khô mắt và gây giảm thị lực của rất nhiều người trên thế giới đặc biệt ở khu vực châu Phi và
Đông Nam Á.
B. HỆ THỐNG CÁC BÀI TẬP VỀ CÔNG NGHỆ ADN TÁI TỔ HỢP
1. Bài tập liên quan đến enzim giới hạn
1.1 Xác định số điểm cắt của enzim giới hạn
- Phân tử ADN mạch vòng có n điểm giới hạn sẽ tạo ra n đoạn khi xử lý bằng enzym giới hạn.
- ADN mạch thẳng có n điểm giới hạn sẽ tạo ra n+1 đoạn.
Ví dụ 1: Khi cắt plasmid pBR322 bằng HaeI, có 11 đoạn ADN được tạo ra. Khi cắt nó
bằng BamHI, chỉ có một đoạn được tạo ra. Có bao nhiêu đIểm giới hạn cho mỗi loại
enzym?
Trả lời:


ADN của plasmid có mạch vòng. Vậy có 11 điểm giới hạn cho HaeI và 1 cho BamHI.
Ví dụ 2: Một phân tử ADN mạch thẳng được cắt bằng EcoRI và tạo ra các đoạn 3 kb,
4,2 kb và 5 kb. Hãy xác định bản đồ giới hạn của nó.
Trả lời:
Có ba đoạn, vậy phải có 2 điểm giới hạn. Các điểm đó có thể phân bố như sau:

1.2. Đột biến ở điểm giới hạn có thể làm mất một hoặc một số đoạn và làm xuất hiện
một đoạn mới, dài hơn.
Ví dụ 1: Khi xử lý một gen (đoạn ADN) bằng BgIII, nó tạo ra các đoạn 1,7 kb, 2,1 kb và 3,2 kb.
- Khi xử lý đoạn ADN tách ra từ một đột biến không tổng hợp được enzym của gen
này bằng BgIII, người ta chỉ thấy hai đoạn 3,2 và 3,8 kb. Điều gì đã xảy ra?
- Khi xử lý ADN được tách ra từ một đột biến khác bằng BgIII, người ta thấy xuất
hiện các đoạn 1,3 kb, 1,7 kb, 1,9 kb và 2,1 kb. Hãy giải thích kết quả thu được.
Trả lời:
- Đột biến đã làm thay đổi một hoặc một số bazơ tại điểm nhận biết của BgIII, và, như vậy,
enzym chỉ cắt phân tử một lần. Đoạn mới là tổng của hai đoạn 1,7 và 2,1 kb, cho thấy hai
đoạn này nằm kề nhau trên phân tử ADN bình thường.
- Chúng ta thấy các đoạn 1,7 và 2,1 kb cùng có cả ở ADN bình thường và ADN đột biến.
Điểm giới hạn sinh ra hai đoạn này phải còn nguyên vẹn trên ADN đột biến. Hai đoạn còn
lại, 1,3 và 1,9 kb có tổng là 3,2 kb, đúng bằng đoạn bị mất. Vậy, một điểm giới hạn mới đã
được tạo ra ở ADN gốc.
1.3. Nếu một đoạn do enzym giới hạn tạo ra cùng xuất hiện khi xử lý bằng một enzym
và bằng hỗn hợp hai enzym thì đoạn đó không có điểm giới hạn cho enzym thứ hai.
Ví dụ1: Một phân tử ADN mạch thẳng được xử lý bằng các enzym dưới đây và kết quả như sau:
EcoRI: 1,7; 2,1; 3,2 kb.
HaeI: 1,0; 1,4; 4,6 kb.
Hỗn hợp: 0,7; 1,0; 1,4; 1,8; 2,1 kb.
- Những đoạn giới hạn nào của EcoRI không chứa các điểm giới hạn của HaeI và ngược lại?
- Hãy xây dựng bản đò giới hạn của phân tử ADN trên?
Trả lời:
- Đoạn 2,1 của EcoRI cũng xuất hiện trong “hỗn hợp”, vậy nó không có điểm giới hạn của
HaeI. Các đoạn khác của EcoRI mất đi khi xử lý bằng cả hai enzym, nên chúng phải chứa
các điểm giới hạn của HaeI. Tương tự, các đoạn 1,0 và 1,4 của HaeI đều không chứa các
điểm giới hạn của EcoRI


- Vì 1,0 + 0,7 = 1,7, và, 1,4 + 1,8 = 3,2, nên đoạn 1,7 của EcoRI phải có điểm giới hạn cho
HaeI từ một đầu:
E 1,0

H 0,7

E

- Tương tự, đoạn 3,2 cũng phải có điểm giới hạn cho doạn HaeI dài 1,8 từ một đầu:
E

1,8

H

1,4

E

- Khi xắp xếp trật tự có thể có cho các đoạn EcoRI:

- Khi thêm các điểm giới hạn đã biết của HaeI vào đúng vị trí. Một trong những trật tự có
thể là:

Chúng ta nhận được đoạn 3,1 kb khi xử lý ADN chỉ bằng HaeI. Nếu trật tự là 2,1; 0,7; 1,0;
1,4 và 1,8, thì khi xử lý bằng HaeI phải tạo ra đoạn 2,8 kb. Vậy, đoạn 1,7 kb không nằm ở
giữa. Nếu đoạn 3,2 kb nằm ở giữa, chúng ta phải gặp, hoặc đoạn 3,5 kb, hoặc đoạn 3,9 kb
khi xử lý bằng HaeI. Điều đó không xảy ra, vậy trật tự phải là:

Nếu điểm giới hạn của HaeI là 0,7 kb từ một đầu, thì ta phải gặp đoạn 0,7 kb khi xử lý ADN
bằng HaeI. Biện luận tương tự cho đoạn 1,8 kb.
2. Bài tập liên quan đến ADN tái tổ hợp
Ví dụ 1: Một plasmid chứa các gen kháng ampicillin và tetracycline. Plasmid đó chứa một
điểm giới hạn nằm trong gen tetracycline. Plasmid đó được xử lý với enzym giới hạn trộn
với ADN ngoại lai, rồi đem ủ với E. coli. Bằng cách nào bạn có thể tách được các tế bào có
plasmid lai?
Trả lời:
Cấy các tế bào trên môi trường có chứa ampicillin và chọn các tế bào sinh trưởng được. Các
tế bào có plasmid sẽ có gen ampicillin trọn vẹn. Cấy sao chép các tế bào này vào môi trường
chứa tetracycline. Những tế bào không sinh trưởng được là những tế bào mang các gen có
đoạn xen. Trở lại với các tế bào gốc trên môi trường chứa ampicillin để lấy ra những tế bào
không sinh trưởng được trên môi trường chứa tetracycline.


Ví dụ 2: Xử lý ADN hệ gen người với EcoRI rồi phân tách các đoạn tạo ra bằng điện
di. Các băng ADN được chuyển sang màng lọc rồi ủ với cADN mã hoá insulin đánh
dấu phóng xạ. Kết quả như sau: (* = các băng có đánh dấu phóng xạ).

C
ó thể kết luận gì từ thí nghiệm này?
Trả lời:
- Hai băng được đánh dấu * có chứa các trình tự bổ trợ với cADN insulin, và, đó chắc là
những phần của gen insulin. Sự có mặt của hơn 1 băng cho thấy gen này có chứa điểm giới
hạn của EcoRI.
3. Bài tập liên quan đến giải trình tự gen
Ví dụ 1: Một phân tử ADN được giải trình tự bằng phương pháp Maxam-Gilbert. Hãy xác
định trình tự ADN từ bản gen thu được sau:

Trả lời: Các
bazơ đầu 5’ sẽ ở gốc bản gen. Vì nó chỉ xuất hiện ở cột C+T, nên nó phải là T. Các băng tiếp
theo xuất hiện cả ở cột C và C+T, nên nó phải là C. Trình tự chung là 5’TCATCGCC 3’.
Ví dụ 2: Một phân tử ADN được giải trình tự bằng phương pháp dideoxy. Dựa trên
bản gel thu được dới đây, hãy xác định trình tự ở sợi làm khuôn.


Trả lời: Khi đọc trình tự của gen bắt đầu đọc tại đầu 5’ ở dưới cùng. Vậy trình tự sẽ là
5’CCAGTTCA 3’. Đó là trình tự của sợi mới được tổng hợp. Vậy trình tự sợi khuôn là
3’GGTCAAGT 5’.
4. Bài tập vận dụng
Bài 1:
Phân lập và tách dòng một đoạn ADN được biết là trình tự duy nhất trong hệ gen. Đoạn
AND này nằm ở đầu của NST X và có độ dài khoảng 10kb. Đánh dấu đầu 5’ với 32P và cắt
đoạn này với EcoRI. Ta nhận được 2 đoạn: một đoạn dài 8,5kb và đoạn kia dài 1,5kb. Tách
đoạn 8,5kb khỏi đoạn 1,5kb, chia mẫu thành hai phần, phần thứ nhất được xử lí với HaeIII,
phần còn lại được xử lí với HindII. Sau đó điện di trên gel agarose. Bằng phương pháp
phóng xạ tự ghi, người ta thu được kết quả như sau:

Hãy vẽ bản đồ giới hạn của đoạn 8,5kb?
Trả lời:


- Khi đánh dấu đầu đầu 5’ với 32P và sử dụng phóng xạ tự ghi thì chỉ những đoạn ADN có
đầu 5’32P mới hiện lên trên ảnh và những đoạn ngắn nhất sẽ chạy xa nhất.
- Đánh số thứ tự các đoạn từ trên xuống dưới ta được hình ảnh như sau:

- Theo ảnh phóng xạ tự ghi ta thấy vạch trên cùng ở cả hai bên là điểm cắt của EcoRI.
+ Khi cắt bằng HaeIII tạo ra 7 đoạn vậy HaeIII có 7 điểm cắt, còn cắt bằng HindII tạo ra 5
đoạn vậy HindII có 5 điểm cắt.
+ Ở cả hai ảnh đều có các vạch trùng nhau (vạch 1 và 4) chứng tỏ HeaIII và HindII có vị trí
cắt sát nhau do đó độ dài các đoạn ADN xấp xỉ nhau. Vì thế tại những điểm đó có khó có
thể xác định enzim nào cắt trước, enzim nào cắt sau.
- Đoạn ngắn nhất là đoạn 10 do đó đoạn này được cắt bởi HaeIII và vị trí cắt gần trình tự
đánh dấu nhất.
- Vậy Trình tự vị trí cắt của enzim đọc từ đầu đánh dấu là: 32P5’ HaeIII → HindII →
HaeIII→ HindII → HindII → HaeIII → HindII → HaeIII →HaeIII → HindII→HaeIII →
EcoRI
Lưu ý: Phần gạch chân có thể đảo vị trí của hai enzim.
Bài 2; Một phân tử ADN, sau khi được tinh sạch cần lập bản đồ vị trí cắt giới hạn. Sau
khi cắt bằng enzim EcoRI thu được 4 đoạn đánh số thứ tự 1,2,3,4. Sau đó cắt mỗi đoạn
này bằng HindII, ta thấy doạn 3 tạo ra hai đoạn con là 3 1 và 32. Đoạn 2 tạo ra 3 đoạn
con (21,22 và 23). Nếu làm ngược lại, sau khi cắt phân tử ban đầu với HindII, nhận
được 4 mảnh A,B,C và D. Sau đó xử lí các mảnh này với EcoRI, mảnh D tạo ra các
đoạn 1 và 31, mảnh A tạo ra 32 và 21, mảnh B tạo ra 23 và 4. Mảnh C giống đoạn 22. Hãy
vẽ bản đồ giới hạn của phân tử ADN này.
Trả lời:
- Sau khi cắt bằng enzim EcoRI thu được 4 đoạn đánh số thứ tự 1,2,3,4. Minh họa như sau
(1) EcoRI (2) EcoRI (3) EcoRI (4)

- Khi tiếp tục xử lí bằng HindII thu được kết quả minh họa như sau:
(1)EcoRI (21 ) HindII (22 )HindII (23) EcoRI (31) HindII (32) EcoRI (4)


-Khi làm ngược lại, sau khi cắt phân tử ban đầu với HindII, nhận được 4 mảnh A,B,C và D.
Sau đó xử lí các mảnh này với EcoRI, mảnh D tạo ra các đoạn 1 và 3 1, nghĩa là đoạn (1) và
(3) ban đầu nằm gần nhau hơn. Và đoạn D nằm đầu tiên.
- Mảnh A tạo ra 32 và 21, suy ra đoạn 2 nằm sau đoạn 3, đoạn A tiếp giáp đoạn D
- Mảnh B tạo ra 23 và 4, là mảnh sau cùng
Mảnh C giống đoạn 22. Nằm giữa A và B
Vậy bản đồ giới hạn của ADN như sau:

Bài 3: Một nhiễm sắc thể dạng thẳng của phage được đánh dấu với với 32P và cắt với
các enzim giới hạn.
- Cắt bằng EcoRI tạo ra các đoạn có kích thước 2,9; 4,5; 6,2; 7,4 và 8,0 kb. Bản phóng
xạ tự ghi cho thấy dấu phóng xạ xuất hiện tại băng 6,2 và 8,0 kb.
- Cắt bằng BamHI tạo ra các đoạn có kích thước 6,0; 10,1 và 12,9 kb. Bản phóng xạ tự
ghi cho thấy dấu phóng xạ xuất hiện tại băng 6,0 và 10,1 kb.
- Cắt đồng thời bằng EcoRI BamHI tạo ra các đoạn có kích thước 1,0; 2,0; 2,9; 3,5;
6,0; 6,2 và 7,4 kb.
a. Vẽ bản đồ giới hạn của phân tử AND trên
b. Mẫu dò phóng xạ được tạo thành từ gen X của phage được tạo dòng đưa vào bản
Southern blot từ sản phẩm cắt với các enzim đơn phân tử ADN phage. Bản phóng xạ
tự ghi cho thấy mẫu dò phóng xạ lai với các băng có kích thước 4,5; 10,1 và 12,9 kb.
Xác định vị trí của gen X trên bản đồ cắt giới hạn.
Trả lời:
a.
- Cắt bằng EcoRI tạo ra các đoạn có kích thước 2,9; 4,5; 6,2; 7,4 và 8,0 kb. Bản phóng xạ tự
ghi cho thấy dấu phóng xạ xuất hiện tại băng 6,2 và 8,0 kb. Vậy đoạn 6,2 và 8,0 là các đoạn
có 32P và nằm ở hai đầu phân tử.
- Cắt bằng BamHI tạo ra các đoạn có kích thước 6,0; 10,1 và 12,9 kb. Bản phóng xạ tự ghi
cho thấy dấu phóng xạ xuất hiện tại băng 6,0 và 10,1 kb. Vậy đoạn 6,0 và 10,1 là các đoạn
có 32P và nằm ở hai đầu phân tử.
- Mặt khác ta thấy đoạn 8,0=6,0 + 2,0
- Cắt đồng thời bằng EcoRI BamHI tạo ra các đoạn có kích thước 1,0; 2,0; 2,9; 3,5; 6,0; 6,2
và 7,4 kb.
Ta có: 4,5= 1,0+3,5; vậy trong đoạn 4,5 tạo ra của EcoRI có 1 điểm cắt của BamHI
12,9= 2,0+7,4+3,5 vậy trong đoạn 12,9 tạo ra của BamHI có 1 điểm cắt của EcoRI


10,1= 1,0+2,9+6,2; vậy trong đoạn 10,1 tạo ra của BamHI có điểm hai cắt của EcoRI
Dựa vào lập luận trên ta có bản đồ của enzim cắt giới hạn như sau

b. Bản phóng xạ tự ghi cho thấy mẫu dò phóng xạ lai với các băng có kích thước 4,5; 10,1
và 12,9 kb. Đoạn 4,5 kb nằm trùm một phần lên đầu các đoạn 12,9 và 10,1.Vậy ta xác định
được gen X chính là đoạn 4,5 kb (như hình dưới đây)

Bài 4: Một đoạn ADN thẳng được cắt bằng các enzim giới hạn riêng biệt HindIII và
SmaI, sau đó cắt phân tử nguyên vẹn bởi đồng thời hai enzim trên. Kết quả thu được
như bảng dưới đây:
HindIII
2,5kb; 5,0kb
SmaI
2,0kb; 5,5kb
HindIII và SmaI
2,5kb, 3,0kb; 2,0kb
a. Hãy vẽ bản đồ giới hạn của phân tử ADN trên.
b. Hỗn hợp tạo ra từ việc cắt bằng đồng thời cả hai enzim trên xử lí với EcoRI, dẫn
đến mất đoạn 3,0kb nhưng lại xuất hiện đoạn 1,5kb. Hãy xác dịnh vị trí cắt giới hạn
trên bản đồ của EcoRI.
Trả lời:
- Mỗi enzim HindIII và SmaI đều có một vị trí cắt. HindIII cắt trong đoạn 5,5kb tạo ra từ
SmaI, ngược lại SmaI cắt trong đoạn 5,0kb tạo ra từ HindIII. Và đoạn 3,0 tạo ra khi cắt đồng
thời bằng cả hai enzim nên nằm ở giữa.
Vậy ta có bản đồ vị trí cắt của cả hai enzim là:

Hỗn hợp tạo ra từ việc cắt bằng đồng thời cả hai enzim trên xử lí với EcoRI, dẫn đến mất
đoạn 3,0kb nhưng lại xuất hiện đoạn 1,5kb. Nghĩa là đoạn 3,0 kb được EcoRI cắt thành hai
đoạn bằng nhau, mỗi đoạn 1,5kb. Vậy vị trí cắt của enzim EcoRI nằm giữa vị trí cắt của hai
enzim ban đầu.


Bài 5: Một phân tử ADN mạch thẳng được cắt bằng PstI, sinh ra các đoạn 4,3, 5,1, và
6,6 kb. Xác định các bản đồ giới hạn phù hợp với kết quả này.
Trả lời: ADN mạch thẳng được cắt bằng PstI, sinh ra các đoạn 4,3, 5,1, và 6,6 kb vậy trên
phân tử này có hai vị trí cắt của enzim PstI. Theo lý thuyết, trong ba đoạn trên chỉ có một
đoạn ở giữa và hai đoạn ở hai bên. Do không có đầy đủ thông tin nên các trình đúng có thể
là một trong các trình tự sau:

Bài 6: Một gen có bản đồ giới hạn sau đây cho enzym BgIII:

Xác định các đoạn sẽ được tạo ra ở đột biến, trong đó:
a

Điểm giới hạn nằm giữa hai đoạn đầu tiên bị đột biến.

b Một điểm giới hạn mới được tạo ra cách đầu trái của gen 2,7 kb.

Trả lời:
a. Khi điểm giới hạn nằm giữa hai đoạn đầu tiên bị đột biến làm mất vị trí nhận biết và cắt
của enzim giới hạn, do vị trí đầu tiên không bị cắt bởi BgIII. Và khi gen ban đầu chỉ bị cắt
thành hai đoạn là 4,9kb và 1,2kb.
b. Khi một điểm giới hạn mới được tạo ra cách đầu trái của gen 2,7 kb sẽ tạo ra them vị trí
cắt trong đoạn 2,8kb, cắt đoạn này thành hai đoạn: 0,6kb và 2,2kb. Vậy sản phẩm cắt trong
trường hợp này là tạo ra các đoạn: 2,1; 0,6; 2,2 và 1,2kb
Bài 7: Cắt ADN mạch thẳng bằng các enzym A và B tạo ra các đoạn sau ( tính bằng kb):
A: 1,1; 2,0; 2,7; 3,2
B: 1,5; 3,5; 4,0
Hỗn hợp hai enzym: 0,3; 0,8; 1,1; 1,2; 2,7; 2,9
Bản đồ nào dới đây không phù hợp với kết quả trên:


Trả lời: Hình b và c không phù hợp với các số liệu đề bài.
- Hình b: Theo sơ đồ trên sẽ tạo ra các đoạn: 1,1; 2,9; 0,3; 1,2; 1,5 và 2,0 kb
- Hình c: Theo sơ đồ trên sẽ tạo ra các đoạn: 1,1; 0,4; 2,8; 1,2; 0,8 và 2,7 kb
Bài 8: Một phân tử ADN bị cắt bằng EcoRI sinh ra một đoạn 16 kb. Khi cắt phân tử
ban đầu bằng BgIII, thu được các đoạn 4,3; 5,5 và 6,2 kb. Khi xử lý bằng cả hai
enzym, thu được các đoạn 2,7; 3,5; 4,3 và 5,5 kb.
a

Bản chất vật lý của ADN?

b Xây dựng bản đồ giới hạn.

Trả lời:
a. Giả sử phân tử ADN ban đầu là phân tử mạch thẳng, khi cắt bằng BgIII, thu được các
đoạn 4,3; 5,5 và 6,2 kb. Vậy trên phân tử này có hai vị trí cắt của BgIII. Khi xử lý bằng cả
hai enzym, thu được các đoạn 2,7; 3,5; 4,3 và 5,5 kb trong đó đoạn 6,2=2,7+3,5 vậy ở đây
chỉ có một vị trí cắt của EcoRI. Tuy nhiên khi chỉ cắt bằng EcoRI chỉ tạo ra một đoạn 16kb
bằng tổng các đoạn trên. Nếu phân tử này mạch thẳng và có một vị trí cắt của EcoRI sẽ tạo
ra hai đoạn con. Vậy giả thiết không phù hợp.
Vậy phân tử AND ban đầu là phân tử mạch vòng.
b. Từ giải thích ở câu a ta có thể vẽ được bản đồ giới hạn như sau:

Bài 9: Một gen dài 4,2 kb được xen vào điểm giới hạn EcoRI của một plasmid 7,4 kb.
Sau đó, plasmid đuợc xử lý bằng HindIII, tạo ra các đoạn 3,8; 4,9 và 2,9 kb. Khi xử lý
bằng cả EcoRI và HindIII, thu được các đoạn 1,1; 1,4; 1,5; 2,7 và 4,9 kb. Những đoạn
nào chứa thông tin của gen?


Trả lời: Phân tử ADN tái tổ hợp chứa hai vị trí cắt của EcoRI và ba vị trí của HindIII. Khi
cắt bằng đồng thời cả hai enzim tạo ra hai đoạn 1,5 và 2,7 kb có tổng kích thước bằng 4,2
(kích thước của gen). Như vậy trong gen có vị trí cắt của HindIII và hai đoạn 1,5 và 2,7 là
hai đoạn chứa thông tin của gen.
Bài 10: Một đoạn ADN người 3,0 kb được trộn với plasmid 7,0 kb cũng bị cắt bởi cùng
loại enzym sinh ra đoạn ADN người. Sau đó tách các phân tử bằng điện di, thu được
các băng tương ứng 3, 6, 7, 10 và 14 kb.
a

Hãy giải thích?

b Phân tử nào được dùng để biến nạp tế bào?

Trả lời:
a. Sau khi được cắt bởi cùng một loại enzim giới hạn tạo ra các đầu dinh bổ sung cho nhau
dẫn đến một số đoạn có thể bắt cặp bổ sung:
- Đoạn 3kb là của đoạn ADN người.
- Đoạn 7kb là của đoạn ADN plasmit.
- Đoạn 6kb là của hai đoạn ADN người.
- Đoạn 7kb là của hai đoạn ADN plasmit.
- Đoạn 14 kb là của ADN tái tổ hợp.
b. Phân tử được dung đề biến nạp vào tế bào là phân tử 14kb
Bài 11: Một plasmid 6,0 kb có chứa các gen kháng ampicillin, tetracycline và
chloramphenicol. Nó còn chứa một điểm giới hạn cho mỗi loại enzym sau: EcoRI,
BgIII, SmaI và PstI. Một gen gây ung thư của chuột được tách và xen vào mỗi điểm
giới hạn. Phân tử lai được dùng để biến nạp E. coli và các thể biến nạp được tính dựa
vào tính kháng với chất kháng sinh. Kết quả nh sau (R = kháng; S = mẫn cảm).
Enym

a

Ampicillin

Tetracycline

Chloramphenicol

EcoRI

R

R

R

BgIII

R

R

S

SmaI

R

S

R

PtsI

S

R

R

Vẽ bản đồ các điểm giới hạn cho mỗi enzym.

b Một plasmid không có ADN ngoại lai được cắt bằng hỗn hợp các enzym dới đây và thu

được các đoạn sau (bằng kb):
EcoRI + SmaI

0,8; 5,2

EcoRI + BgIII

1,3; 4,7

EcoRI + PstI

2,5; 3,5

EcoRI + SmaI + BgIII

0,8; 1,3; 3,9

EcoRI + SmaI + PstI

0,8; 1,7; 3,5

Vẽ lại bản đồ dựa câu a và chỉ rõ khoảng cách.


a. Qua bảng trên ta thấy: BgIII có điểm cắt trong gen kháng chloramphenicol, SmaI có điểm
cắt trong gen kháng Tetracyline và PtsI có điểm cắt tại gen kháng Ampicillin. Điểm cắt của
EcoRI nằm ngoài cả ba gen trên.

b.

Bài 12: Một phân tử ADN mạch thẳng được đánh dấu bằng 32P ở đầu 5’. Sau đó nó
được cắt và tạo ra các đoạn như sau (* = đoạn được đánh dấu phóng xạ)
HindIII

3,0*; 4,0; 5,0*

BgIII

1,8*; 2,2*; 2,7; 5,3

Hỗn hợp

1,2; 1,5; 1,8*; 2,2*; 2,5; 2,8

Vẽ bản đồ giới hạn.
Trả lời:
Phân tử ADN sẽ được đánh dấu các đầu, vì nó là sợi kép. Kết quả xử lý từng loại enzym cho
ta kết quả sau:

Nếu trình tự thứ hai theo BglII là đúng thì việc xử lý bằng hỗn hợp các enzym phải sinh
ra đoạn 0,8 kb. Ta không thấy đoạn đó. Vậy ta có:


Nếu đoạn 5,3 nằm ngay sau đoạn 0,8 thì chúng ta sẽ phải gặp các đoạn 0,1 và 3,1. Không
có các đoạn đó. Nếu đoạn 2,7 nằm sau đoạn 0,8, chúng ta sẽ phải gặp đoạn 1,5 kb.
Vậy bản đồ giới hạn của phân tử là

Bài 13: Phần đầu của một gen được tách và giải trình tự bằng kỹ thuật MaxamGilbert. Kết quả như sau:

a

Trình tự của đoạn này? (Nhớ chỉ rõ đầu 5’, 3’).

b Trình tự của ARN đợc tổng hợp từ sợi này?
c

Bốn axit amin đầu tiên của protein?

Trả lời:


a. 5’ TTGGTCGATGTAATCATCGCC 3’
b. 5’ GGCGAUGAUUACAUCGACCAA 3’
c. met-ile-thr--ser
Khi đọc trình tự thì đọc trình tự từ dới lên, và nhớ rằng đầu 5’ là đầu dưới. Nếu băng xuất
hiện ở cả hai cột C và C+T, thì đó là C. Nếu băng xuất hiện ở cả hai cột A và A+G, thì đó là
A. Hãy nhớ rằng ARN được phiên mã theo chiều 5’ đến 3’ và các axit nucleic ngược chiều.
Để xác định trình tự axit amin, hãy tìm bộ ba đầu tiên theo chiều 5’ đến 3’ rồi lần theo trình
tự các bộ ba.
Bài 14: Nếu một sợi ADN có trình tự 3’ GCTGAACGTCAG 5’ được ủ với triphosphate
đánh dấu phóng xạ và 10% dideoxy CTP thì sẽ xuất hiện những đoạn được đánh dấu
có kích thước bao nhiêu?
Trả lời:
- Phương pháp dideoxy dựa trên nguyên tắc bổ trợ; các đoạn sẽ được tạo ra nơi ddC gắn
vào, bắt đầu từ đầu 5’của sợi mới được tổng hợp.
- Theo nguyên tắc bổ sung ddCTP bổ sung với G mà ở sợi khuôn G ở các vị trí: 1; 4; 8 và 12
nên các đoạn đánh dấu dài 1, 4, 8 và 12 bazơ.
Bài 15: Một người phụ nữ 30 tuổi có thai biết rằng cha bà bị bênh múa giật
Huntington - một bệnh do gen trội trên nhiễm sắc thể thường quy định. Không có
lịch sử bệnh ở gia đình chồng bà. Thí nghiệm cắt ADN bằng enzym giới hạn cho thấy
có mặt alen của bệnh này. Thí nghiệm này được tiến hành trên bố bà, bà, chồng bà và
bào thai. Kết quả như sau:

a. Người phụ nữ có bị bệnh không?
b. Con bà có bị bệnh không?
Trả lời:
Vì bệnh múa giật Huntington di truyền trội, nên có nhiều khả năng ngời bệnh là dị hợp tử,
và vì vậy sẽ tạo ra các đoạn cả từ gen bình thường và gen bị đột biến. Người chồng có gen
bình thờng. Khi so sánh với bố của ngời phụ nữ chúng ta thấy ở ngời bố có hai băng mới có
lẽ là do sự xuất hiện một điểm giới hạn mới tại đoạn đầu của gen bình thờng. Băng thứ ba
và băng thứ năm chứa ADN của cả gen bình thường và gen đột biến. Ngời phụ nữ giống với
bố, vì vậy bà là dị hợp tử. Thai nhi bình thờng. Vậy ta có thể vẽ ADN cho bố bà như sau:

Vậy người phụ nữ này có bị bệnh.


b. Bào thai có các bang điện di giống người chồng không bị bệnh nên đứa trẻ này không bị
bệnh.
Bài 16: ADN lấy từ phôi chuột và tế bào limpho của chuột trưởng thành được cắt bằng
enzym giới hạn và được dò bằng cADN quy định chuỗi nhẹ của phân tử kháng thể
được đánh dấu phóng xạ. Các đoạn đánh dấu phóng xạ xuất hiện như sau:
Phôi

Tế bào limpho






Hãy giải thích kết quả thu được.
Trả lời: ADN phôi bị mất điểm giới hạn và hình thành những điểm mới trong quá trình phát
triển. cADN sẽ gắn với những đoạn có chứa các trình tự của gen quy định kháng thể. Vì có
những đoạn mới xuất hiện, nên các điểm giới hạn cũ đã bị mất và những điểm giới hạn mới
được sinh ra, có lẽ, do sự dịch chuyển các vùng ADN.
Bài 17: Khi nghiên cứu cấu trúc vùng điều hòa của gen X (một gen được biểu hiện ở tế bào
biệt hóa của chuột ), một nhà nghiên cứu đã dùng enzim cắt giới hạn để cắt đoạn AND phía
trước gen X thành nhiều đoạn ngắn có độ dài khác nhau . Sau đó, các đoạn cắt được nối với
gen lacZ (một gen chỉ thị) đã bị cắt bỏ vùng khởi động (promoter). Các AND tái tổ hợp này
được chuyển vào tế bào gan để theo dõi mức độ biểu hiện của gen lacZ. Kết quả theo dõi
được trình bày ở hình dưới đây.

Hãy cho biết vùng nào là vùng khởi động (promoter), vùng nào là vùng tăng cường
(enhancer)của gen X? Giải thích.
Trả lời:
- Vùng M-H nằm cạnh gen lacZ là promoter cua gen X vì trong AND tái tổ hợp, phân tử
nào thiếu đoạn này gen lacZ đều không biểu hiện. Mặt khác, đây là vùng liên kết với yếu tố
phiên mã chung giúp ARN poolimeraza có thể nhận biết và phiên mã nhưng ở mức thấp(chỉ
5 đơn vị).
- Hai vùng M-M không phải là enhancer vì sự có mặt của chúng không làm tăng mức biểu hiện của
lacZ.
- Vùng H-M năm gữa hai đoạn M-M là vùng enhancer vì khi lien kết với promoter thì gen
lacZ đã biểu hiện ở mức cao nhất.


Bài 18: Giả sử một gen mã hóa một prôtêin đặc thù ở vi khuẩn có trình tự nuclêôtit của một mạch
như sau:
5’-ATGACAACCCATC……………………..CCCGAGCACAAGTAA-3’.
Để sản xuất ở quy mô lớn loại prôtêin này, người ta tiến hành nhân dòng đoạn gen trên
vào một vectơ, tạo plasmit tái tổ hợp và biến nạp vào E.coli. Sau đó người ta tiếp tục cho cảm
ứng biểu hiện và sản xuất sinh khối. Để tách protein sản phẩm bằng sắc ký ái lực qua cọt ion
Ni2+, vectơ biểu hiện thường có một trình tự mã hóa 6 axit amin histadin ở đuôi cacbôxyl hoặc ở
đầu amin. Giả sử vị trí phân dòng của vectơ biểu hiện có trình tự là:
5’CGCTGCAGATGAATATGCGCGGGGATCCGACCACCACCACCACCACCAC-3’
(Phần in đậm gạch chân là trình tự nhận biết của enzim cắt giới hạn PstI và BamHI,
phần in nghiêng gạch chân là trình tự nuclêôtit của 6 bộ ba liên tiếp mã hóa axit amin histadin)
Hãy đề xuất trình tự nuclêôtit của cặp mồi nhân dòng để prôtêin đích được gắn thêm 6
axit amin histadin. Giải thích.
Trả lời:
- Để sản phẩm prôtêin có 6 axit amin histadin ở đuôi cacbôxyl thì mã kết thúc phải được phá bỏ
để quá trình giải mã kéo dài bao trùm cả 6 bộ ba mã hóa histadin. Đồng thời trình tự đoạn mồi
cần phải chứa cả enzim cứt giới hạn để có thể nhân dòng phụ sang vectơ biểu hiện. Mặt khác,
để tách được dòng gen, tạo sản phẩm chính xác, trình tự đoạn mồi cần thiết phải bổ sung với
mạch gốc.
- Xem xét trình tự của vectơ, phía sau vị trí nhận biết chứa một bộ ba, tiếp đó là 6 bộ ba mã hóa
histadin. Vì thế, đột biến phá vỡ mã kết thúc phải làm mất hẳn cả 3 nuclêôtit của mã kết thúc
hoặc thêm số nuclêôtit là số chia hết cho 3. Thông thường người ta hạn chế tăng mã bộ ba.
Bởi vậy, trình tự nuclêôtit của cặp mồi tách dòng gen trên có thể là:
Mồi xuôi: 5’-AGCTGCAGATGACAACCATC-3’
Mồi ngược: 5’-ATCGGTACCGAACACGAGCCC-3’
Ghi chú: Nuclêôtit đầu 5’ có thể không nhất thiết bổ sung với mạch khuôn.
Tuy nhiên, để có đoạn mồi chuẩn, chúng ta cần kiểm tra các đặc điểm khác của mồi
trước khi sử dụng. Để đạt các điều kiện tối ưu của mồi, có thể thêm nuclêôtit bất kỳ ở đầu 5’
hoặc kéo dài đoạn bổ sung với mạch khuôn.
Bài 19: Để đánh giá hiệu quả trong chuyển gen thực vật thông qua số bản sao của gen được
chuyển (gen đích), người ta thường sử dụng kỹ thuật lai AND (lai Southern). Trong kỹ thuật
này người ta sử dụng enzim cắt giới hạn có vị trí nhận biết không nằm trên gen đích(hay
vùng thiết kế mẫu dò) để sử lý AND tổng số của các dòng cây chuyển gen. Hình dưới đây
mô phỏng kết quả lai Southern của các mẫu nghiên cứu. Trong đó, giếng M là mẫu AND
chuẩn (Marker); P(positive control) là mẫu đối chứng dương (vectơ mang gen đích chưa bị
cắt; các giếng từ 1 đến 16 là sản phẩm cắt các mẫu AND tổng số bởi enzim giới hạn của 16
dòng cây chuyển gen.
M P 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

10kb
8kb
4kb
2kb
1,5kb
1kb
750bp


500bp
Từ kết quả thu được ở trên, hãy xác định dòng cây nào là dòng chuyển gen mong
muốn? Giải thích.
Trả lời:
- Từ kết quả của hình, ta có thể nhận thấy tất cả 16 mẫu AND của các dòng cây chuyển
gen đều có sản phẩm cắt giới hạn, điều đó chứng tỏ tất cả các dòng cây đều chứa đoạn gen
chuyển (gen đích) với kích thước khác nhau.
+ Các dòng cây 2,6,9,12,13,14,15,16 mang 2 bản sao của gen đích .
+ Các dòng cây 1,3,5 mang 3 bản sao của gen đích .
+ Các dòng cây 10,11 mang 4 bản sao của gen đích .
+ Các dòng cây 4,7,8 mang 1 bản sao của gen đích.
(Ghi chú: Thí sinh không nhất thiết phải phân tích đặc điểm các dòng khác ngoài các
dòng cây 4,7,8)
- Khi chuyển gen, người ta muốn có bản sao của gen đích được tái tổ hợp vào NST của
tế bào vật chủ. Tuy nhiên, việc đoạn gen đích được chèn vào nhiều điểm khác nhau hoặc
trên nhiều nhiễm sắc thể là điều không mong muốn. Vì thế, những dòng có 1 bản sao của
gen đích là dòng mong muốn để chọn lọc tiếp. Từ đó có thể kết luận, dòng cây mong muốn
trong nghiên cứu này là các dòng 4,7,8.
5. Các bài tập tự giải
Bài 1
Dưới đây là phả hệ ghi lại sự di truyền của bệnh PKU (phenylketo niệu) do một đột
biến gen lặn ở gen PAH (gen mã hóa cho phenylalanin hydroxylase). Phía dưới phả hệ là
kiểu RFLP (đa hình chiều dài các đoạn cắt giới hạn) cho từng các thể đối với gen PAH. Cá
thể II-2 bị bệnh PKU.

Từ 2 sơ đồ minh họa kết quả điện di các mẫu ở trên, hãy cho biết kết quả điện di của
các mẫu II-2, II-4 thuộc mẫu nào trong số các mẫu từ A D. Giải thích.
Câu 39.
ADN từ 5 thành viên của một gia đình, trong đó có một thành viên bị chứng lùn (hình
A), đã được phân tích bởi các enzym cắt giới hạn, lai với đoạn đánh dấu và điện di trên gen
(hình B). Hiện tượng lùn là do bất hoạt một hormon sinh trưởng.


a) Xác định đoạn chứa gen quy định hormon sinh trưởng
b) Tính xác suất sinh con bị bệnh của cá thể III-4.
Bài 2
Một nông dân có 3 con bò đực. Một ngày, một trong số các con bò cái của ông đến kỳ
động dục và bằng cách nào đó được bố trí đưa đến đồng cỏ ăn cùng với các con bò đực kia.
Như mong đợi, bò cái đã sản sinh được một con bê, tuy nhiên người nông dân không biết
chắc con bò nào là bố của con bê mới sinh ra. Cán bộ khuyến nông khuyên ông ấy đến trung
tâm xét nghiệm ADN nếu muốn biết con bò đực nào là bố của con bê vừa mới sinh. Hình
dưới là hình ảnh minh họa kết quả phân tích di truyền của 2 locus của các cá thể. Dựa vào
thông tin ở hình minh họa ở bên, hãy cho biết bò đực nào là bố của con bê vừa mới sinh?
Giải thích.

Bài 3
Để lập bản đồ cắt giới hạn của một plasmid
chứa vị trí nhận biết của 2 enzim EcoRI và BamHI,
một sinh viên đã tiến hành các phản ứng cắt của từng
enzim và của cả 2 enzim. Sau phản ứng cắt, sinh viên
đó đã tiến hành điện di và thu được kết quả như hình
minh họa ở bên. Hãy xác định kích thước và vẽ bản
đồ cắt giới hạn của plasmid trên.

Bài 4
Một nhà nghiên cứu đã nghiên cứu chức năng của gen X trong lúa bằng sử dụng đột
biến với T-DNA được chèn vào exon 2 như hình vẽ dưới. Kích thước của T-DNA khoảng


5kb. Ông ấy sử dụng PCR để nghiên cứu sự di truyền của các loại thực vật khác nhau (A, B,
C, D, E) với các mồi I, II và III như hình vẽ dưới. Gel mô tả kết quả PCR ở bên phải bao
gồm markers: lane M; lane A-E là sản phẩm PCR từ mẫu lá của thực vật tương ứng từ A-E.

Được biết ADN pol được sử dụng không khả thi cho kích hoạt đoạn có độ dài trên 5kb. Hãy
cho biết:
a) Cặp mồi nào (I và II; I và III; II và III) kích hoạt vạch ADN ở mẫu B? Giải thích.
b) Thực vật nào (A, B, C, D, E) là đột biến đồng hợp tử? Giải thích.
Bài 5
Giả sử bạn đang thử nhân dòng 1 gen đã được cắt bởi enzim cắt giới hạn EcoRI (hình
dưới) vào plasmid. Tuy nhiên, plasmid của bạn chỉ có trình tự nhận biết của BamHI mà
không có trình tự nhận biết của enzim EcoRI.

Bạn sẽ thực hiện việc nhân dòng thế nào trong các trường hợp sau?
a) Ở phía ngoài khung đọc của gen có trình tự nhận biết của enzim BamHI
b) Ở phía ngoài khung đọc của gen không có trình tự nhận biết của enzim BamHI
c) Ở bên trong khung đọc của gen cho có trình tự nhận biết của enzim BamHI
Bài 6
Hình dưới mô tả cấu trúc của plasmid (A), gen cho (B) và trình tự nhận biết của enzym
cắt giới hạn (C). Để biểu hiện gen này, cần phải chèn vào plasmid trình tự vùng mã hóa và
tín hiệu kết thúc để tạo plasmid tái tổ hợp. Hãy mô tả phương pháp tạo plasmid tái tổ hợp
mong muốn. Giải thích.

PHẦN BA: KẾT LUẬN


Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×