Tải bản đầy đủ (.pdf) (8 trang)

Xác định đột biến gen KIT trong u mô đệm đường tiêu hóa bằng kỹ thuật giải trình tự chuỗi DNA

Bạn đang xem bản rút gọn của tài liệu. Xem và tải ngay bản đầy đủ của tài liệu tại đây (506.62 KB, 8 trang )

Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011

Nghiên cứu Y học

XÁC ĐỊNH ĐỘT BIẾN GEN KIT TRONG U MÔ ĐỆM
ĐƯỜNG TIÊU HÓA BẰNG KỸ THUẬT GIẢI TRÌNH TỰ CHUỖI DNA
Hoàng Anh Vũ*, Hoàng Đức Trình**, Ngô Quốc Đạt***, Hứa Thị Ngọc Hà***

TÓM TẮT
Giới thiệu: U mô đệm đường tiêu hóa (GIST: Gastrointestinal Stromal Tumor) là u trung mô thường gặp
nhất của đường tiêu hóa, thường có CD117 (+). Đột biến gen KIT gặp trong khoảng 60 – 80% trường hợp GIST,
là đích điều trị của imatinib. Mặc dù thuốc này đã được chỉ định tại Việt Nam, nhưng chưa có nghiên cứu nào
khảo sát đột biến gen KIT trong GIST.
Đối tượng và phương pháp nghiên cứu: 32 trường hợp GIST chẩn đoán tại Bộ môn Giải Phẫu Bệnh, Đại
học Y Dược TP.Hồ Chí Minh từ tháng 1/2010 đến 3/2011 được khảo sát đột biến KIT tại 4 exon 9, 11, 13 và 17.
Sau khi khuếch đại thành công bằng PCR từ bệnh phẩm là mô vùi nến, đột biến của KIT được xác định bằng kỹ
thuật giải trình tự chuỗi DNA.
Kết quả: 22 bệnh nhân có đột biến KIT (68,7%). Đột biến gặp ở mọi vị trí GIST được khảo sát bao gồm dạ
dày, ruột non, ruột già, mạc treo và sau phúc mạc. Cả 9 trường hợp u lớn hơn 10 cm đều có đột biến so với chỉ 4
đột biến được phát hiện ở 10 trường hợp u nhỏ hơn 5 cm. Đột biến nhạy với imatinib ở exon 11 thường gặp nhất
(17/22) và rất đa dạng, bao gồm đột biến điểm, đột biến mất đoạn, chèn đoạn và đột biến phức tạp. Các đột biến ít
nhạy với imatinib cũng được phát hiện ở exon 9 (1 bệnh nhân) và exon 17 (4 bệnh nhân).
Kết luận: Kỹ thuật giải trình tự chuỗi DNA có thể ứng dụng trong chẩn đoán đột biến KIT, giúp lựa chọn
bệnh nhân GIST trong chỉ định điều trị imatinib.
Từ khóa: đột biến gen c-kit, u mô đệm đường tiêu hóa, giải trình tự chuỗi DNA.

ABSTRACT
C-KIT GENE MUTATIONS IN GIST BY DNA SEQUENCING METHOD
Hoang Anh Vu, Hoang Duc Trinh, Ngo Quoc Dat, Hua Thi Ngoc Ha
* Y Hoc TP. Ho Chi Minh * Vol. 15 - Supplement of No 2 - 2011: 66 - 73
Background: Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor of the


intestinal tract, often showing CD117 expression. About 60 –80% of GISTs have activating mutations of the KIT
gene, which are therapeutic targets for imatinib. Although imatinib has recently been indicated for GIST patients
in Vietnam, KIT mutations were not investigated.
Material and method: Tumors from 32 patients with GIST diagnosed at Department of Pathology from
January 2010 to March 2011 were searched for mutations in KIT exons 9, 11, 13, and 17. PCR was used to
amplify 4 exons from DNA of paraffin-embedded tissue samples, followed by direct DNA sequencing.
Results: In total, 22 mutations were detected in all sites of GIST including stomach, small intestine, colon,
mesentery, and retroperitoneum. All 9 tumors more than 10 cm in size have mutations, in comparison with 4 of
10 tumors less than 5 cm have mutations. Imatinib-sensitive mutations in exon 11 are the most common
mutations detected (17 out of 22), which include point mutation, deletion, insertion, and complex mutation. In
** Bộ môn Giải Phẫu Bệnh, Trường Đại học Y Dược Cần Thơ
Bộ môn Mô – Phôi, Đại học Y Dược TP.HCM
*** Bộ môn Giải Phẫu Bệnh, Đại học Y Dược TP.HCM
Tác giả liên lạc: TS.BS. Hoàng Anh Vũ
ĐT: 01222993537
Email: hoangvuxinh@yahoo.com
*

Chuyên Đề Giải Phẫu Bệnh

67


Nghiên cứu Y học

Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011

addition, 1 mutation was found in exon 9 and 4 in exon 17.
Conclusion: DNA sequencing can detect KIT mutations for selecting GIST patients benefit from imatinib
therapy.

Key words: c-kit mutation, Gastrointestinal Stromal Tumor (GIST), direct DNA sequencing.

ĐẶT VẤN ĐỀ

ĐỐI TƯỢNG - PHƯƠNG PHÁP NGHIÊN CỨU

U mô đệm đường tiêu hóa (GIST:
gastrointestinal stromal tumor) tương đối hiếm
gặp, chiếm < 1% u ác tính của đường tiêu hóa(2).
U xuất phát từ tế bào kẽ của Cajal, thường biểu
hiện CD117 trong bào tương và bề mặt tế bào.
Ngoài phẫu thuật là điều trị chuẩn cho những
trường hợp chưa di căn, u thường đề kháng với
hóa trị liệu kinh điển và xạ trị.

Đối tượng nghiên cứu

Phần lớn GIST có mang đột biến của gen
KIT hoặc gen PDGFRA, là hai gen cùng thuộc
gia đình receptor tyrosine kinase. Trong tế
bào bình thường gen KIT và gen PDGFRA chỉ
được hoạt hóa khi có gắn với chất truyền tín
hiệu ngoại bào (SCF: Stem Cell Factor). Đột
biến của KIT xảy ra trong 60 – 80% trường
hợp GIST và khi đó gen KIT được hoạt hóa
liên tục một cách độc lập với SCF(14). Trong
nhóm GIST không có đột biến KIT, khoảng
phân nửa số bệnh nhân có đột biến PDGFRA.
Đột biến của cả 2 gen này đều là đích điều trị
của imatinib. Tuy nhiên, mức độ nhạy với

imatinib không phải giống nhau giữa các kiểu
đột biến. Đột biến của KIT thường gặp nhất ở
exon 11 và nhạy với imatinib; các đột biến ở
exon 9, 13 và 17 hiếm gặp hơn và ít nhạy với
imatinib(5). Vì thế, việc xác định đột biến của
KIT rất có ý nghĩa trong điều trị imatinib cho
bệnh nhân.
Tại Việt Nam, mặc dù imatinib đã được
chỉ định điều trị cho GIST giai đoạn tiến xa
với những đáp ứng ban đầu đầy triển vọng
được báo cáo trong thời gian gần đây(17), vẫn
chưa có nghiên cứu nào khảo sát đột biến KIT
trên bệnh nhân GIST. Nghiên cứu này nhằm
xác lập quy trình kỹ thuật giải trình tự chuỗi
DNA để xác định đột biến KIT từ bệnh phẩm
là mô vùi nến và mô tả đặc điểm đột biến KIT
của bệnh nhân Việt Nam.

68

32 trường hợp GIST được chẩn đoán tại Bộ
môn Giải Phẫu Bệnh – Đại học Y Dược TP.HCM
trong thời gian từ tháng 1/2010 đến 3/2011. Chẩn
đoán GIST được xác định bằng tiêu bản nhuộm
Hematoxylin – Eosin và nhuộm hóa mô miễn
dịch với dấu ấn CD117 dương tính (+++).

Tách chiết genomic DNA
Bệnh phẩm là mô vùi nến đã dùng để chẩn
đoán giải phẫu bệnh. Vùng mô ung thư được

đánh dấu trên lam giải phẫu bệnh để phân biệt
với vùng mô lành xung quanh rồi được cạo vào
tube ly tâm 1,5 mL nhằm tăng khả năng chẩn
đoán được đột biến. Xylene (Merck, Đức) được
thêm vào tube ly tâm 2 lần để khử nến, sau đó
được rửa lại bằng ethanol tuyệt đối và để khô
trước khi ủ với proteinase K (Invitrogen, Mỹ) ở
480C trong 16 giờ. Tinh sạch sản phẩm DNA sau
khi ủ proteinase K được thực hiện bằng phenol
– chloroform (Invitrogen, Mỹ). Cuối cùng, kết
tủa DNA bằng ethanol tuyệt đối trong muối
NH4OAC và định nồng độ DNA bằng
spectrophotometer.

Khuếch đại các exon bằng PCR
Các đoạn mồi được thiết kế bằng phần
mềm Oligo 4.1 dựa trên trình tự chuẩn của
KIT mang accession number NG_007456 trong
GenBank (Bảng 1). Trong mỗi tube PCR có
tổng thể tích 50 µL, các thành phần gồm có
PCR buffer, dNTP (250 µM cho mỗi loại), 2
loại mồi xuôi và ngược (0,5 µM cho mỗi loại),
1,25 unit TaKaRa TaqTM HotStart Polymerase
(Takara, Nhật Bản) và 20 ng genomic DNA.
Chu kỳ luân nhiệt được thực hiện trên máy
GeneAmp® PCR system 9700 (Applied
Biosystems, Mỹ) bao gồm giai đoạn biến tính
ban đầu ở 980C trong 2 phút, theo sau bằng 40
chu kỳ gồm biến tính ở 980C trong 10 giây,


Chuyên Đề Giải Phẫu Bệnh


Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011
gắn mồi ở 600C trong 15 giây, tổng hợp chuỗi
DNA ở 720C trong 1 phút và kết thúc bằng
giai đoạn kéo dài sản phẩm ở 720C trong 5
phút. Sản phẩm PCR được phát hiện bằng
điện di trên thạch agarose 2% có nhuộm
ethidium bromide và quan sát dưới màn soi
gel Pringraph (Atto, Nhật Bản). Sản phẩm
PCR được tinh sạch bằng QIAquick Gel
Extraction kit (Qiagen, Mỹ) và được kiểm tra
lại bằng điện di trên thạch agarose 2%.
Bảng 1: Các đoạn mồi dùng trong nghiên cứu đột
biến KIT
Tên mồi

Trình tự DNA (5’---3’)

KIT-9F
KIT-9R
KIT-11F
KIT-11R
KIT-13F
KIT-13R
KIT-17F
KIT-17R

AGTATGCCACATCCCAAGTG

CAGAGCCTAAACATCCCCTTA
CCAGAGTGCTCTAATGACTG
ACCCAAAAAGGTGACATGGA
CATCAGTTTGCCAGTTGTGC
CAGCTTGGACACGGCTTTAC
GAACATCATTCAAGGCGTAC
TTTACATTATGAAAGTCACAGG

Exon
được
khuếch
đại

Sản
phẩm
PCR
(bp)

9

317

11

236

13

182


17

392

Thực hiện giải trình tự chuỗi DNA
Sản phẩm PCR đã được tinh sạch sẽ được
thực hiện phản ứng cycle sequencing với
BigDye V3.1 từ Applied Biosystems, theo 2
chiều xuôi và ngược cho mỗi exon. Sản phẩm
sau đó được kết tủa bằng ethanol, hòa tan trong
Hi-Di formamide, biến tính ở 950C trong 2 phút
trước khi làm lạnh đột ngột. Trình tự DNA được
đọc bằng máy ABI 3130 Genetic Analyzer, với
POP-7 polymer và capillary 50 cm (Applied
Biosystems, Mỹ). Kết quả được phân tích bằng
phần mềm SeqScape, so sánh với trình tự tham
chiếu của KIT mang accession number
NG_007456 để chẩn đoán tình trạng đột biến của
các exon.

KẾT QUẢ VÀ BÀN LUẬN
Về giải trình tự gen KIT trên mô u vùi nến
Gen KIT gồm 21 exon, mã hóa cho protein
cùng tên có 976 acid amin, thuộc gia đình thụ
thể tyrosine kinase loại III. Protein này có thể
được phát hiện bằng nhuộm hóa mô miễn dịch

Chuyên Đề Giải Phẫu Bệnh

Nghiên cứu Y học


với kháng thể kháng protein KIT, hay còn gọi là
kháng thể kháng CD117. GIST có thể dương tính
với dấu ấn CD117 trong cả trường hợp KIT đột
biến và KIT không đột biến(13).
Đột biến KIT có thể gặp trong nhiều loại ung
thư khác nhau như bệnh bạch cầu cấp dòng
tủy(6), u tế bào mầm tinh hoàn và buồng
trứng(3,11). Trong GIST, đột biến KIT chủ yếu xảy
ra trong 4 exon 9, 11, 13 và 17(8,16).
Để có thể giải trình tự chuỗi DNA, bước
quyết định là phải khuếch đại được các exon
muốn tìm đột biến từ mô vùi nến. Chúng tôi
thiết kế các cặp mồi đặc hiệu cho từng exon, và
thành công trong việc khuếch đại các exon này
bằng PCR (Hình 1A). Trong điều kiện PCR đã
được thiết lập, nhiệt độ bắt cặp của cả 4 cặp mồi
là 600C, giúp khuếch đại cùng lúc 4 exon bằng
một chương trình luân nhiệt rất thuận lợi. Trong
một số trường hợp, kết quả điện di trên thạch
agarose đã cho thấy các băng có kích thước bất
thường, tương ứng với đột biến mất hoặc thêm
nucleic acid.
Bản chất của các đột biến được xác định
bằng kỹ thuật giải trình tự chuỗi DNA. Chúng
tôi phát hiện 22 trường hợp có đột biến trong 32
trường hợp đã khảo sát (68,7%), tương đương
với số liệu của hầu hết các nghiên cứu khác có
sử dụng mô vùi nến(7,13,16). Bảng 2 cho thấy các
đột biến có khuynh hướng thường gặp trên

những khối u lớn hơn 10 cm (9/9), ít gặp trên u
nhỏ hơn 5 cm (4/10). Tuy nhiên, vì số liệu
nghiên cứu này còn nhỏ, chúng tôi cần thêm
nhiều trường hợp hơn để rút ra kết luận về mối
liên quan giữa đột biến và kích thước u. Về bản
chất, các đột biến được phát hiện rất đa dạng,
bao gồm đột biến điểm, đột biến mất đoạn, chèn
đoạn và đột biến phức tạp (Hình 1B – D). Kết
quả này chứng tỏ kỹ thuật của chúng tôi đáng
tin cậy trong việc phát hiện đột biến của KIT từ
bệnh phẩm giải phẫu bệnh đã qua thời gian dài
lưu trữ. Đây là bệnh phẩm thường được sử
dụng nhất khi chẩn đoán trên lâm sàng, vì thế
nghiên cứu của chúng tôi có thể ứng dụng cho
những trường hợp cần xác định đột biến KIT

69


Nghiên cứu Y học

Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011

cho bệnh nhân GIST muốn được điều trị bằng
imatinib. Tỷ lệ đột biến trong một số báo cáo có
thể cao hơn, thường do được khảo sát đột biến
từ mô tươi, khảo sát toàn bộ các exon của KIT

A
M 1


BN 6
2 3

B

BN 7
4 1

2

3

hoặc khảo sát ở mức RNA(1). Tuy nhiên các điều
kiện này không dễ thực hiện trong thực hành
lâm sàng.

4 N

C

D

Hình 1: Phát hiện các đột biến KIT bằng giải trình tự chuỗi DNA. (A) Khuếch đại 4 exon 9, 11, 13 và 17 (các
giếng 1 – 4) trên bệnh nhân 6 và 7 bằng PCR. Bệnh nhân 7 có băng thêm đoạn ở exon 11 (giếng 2). (B) Hình ảnh
đột biến thêm đoạn của exon 9. (C) Đột biến điểm của exon 17. (D) Các đột biến điểm và mất đoạn của exon 11.
hướng hay gặp hơn ở những u có kích thước
Về ý nghĩa lâm sàng – giải phẫu bệnh của
lớn, sự xuất hiện đột biến không liên quan tới
các trường hợp đột biến KIT

đặc điểm mô học của u hay chỉ số phân bào.
Trong 22 trường hợp có đột biến, 17 đột
Kết quả này gợi ý rằng đột biến ở exon 11 nên
biến ở exon 11 – chiếm 53,1% (Bảng 2 và 3).
được khảo sát cho tất cả các trường hợp GIST.
Trong tất cả các nghiên cứu về GIST, đột biến
Bảng 2: Đặc điểm lâm sàng – giải phẫu bệnh và đột
exon 11 thường gặp nhất và đều là những đột
biến KIT trong nghiên cứu
biến nhạy với imatinib(7,10). Với những bệnh
Có đột biến
Không
nhân này, liều điều trị imatinib được khuyến
đột
biến
Exon 9 Exon 11 Exon 17
cáo là 400 mg/ngày(4). Bảng 2 cho thấy đột
Số trường hợp (n = 32)
1
17
4
10
biến ở exon 11 xuất hiện với tỷ lệ tương
Tuổi trung bình
76
58
55
52
đương ở bệnh nhân nam và nữ, có thể gặp ở
Giới

Nam (15)
1
8
1
5
tính
tất cả mọi vị trí của GIST được khảo sát, bao
Nữ (17)
0
9
3
5
gồm dạ dày, ruột non, ruột già, sau phúc mạc
Vị trí
Dạ dày (17)
0
9
2
6
Ruột
non
(9)
1
4
1
3
và mạc treo. Mặc dù đột biến có khuynh
Mạc treo (4)

70


0

3

1

0

Chuyên Đề Giải Phẫu Bệnh


Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011
Có đột biến
Không
Exon 9 Exon 11 Exon 17 đột biến
Sau phúc mạc
0
1
0
1
(2)
Loại tế Hình thoi (24)
1
12
4
7
bào Dạng biểu mô
0
3

0
2
(5)
Hỗn hợp (3)
0
2
0
1
Kích
< 5 cm (10)
0
2
2
6
thước u 5-10 cm (13)
1
7
1
4
> 10 cm (9)
0
8
1
0

Nghiên cứu Y học

Có đột biến
Không
Exon 9 Exon 11 Exon 17 đột biến

Chỉ số < 5 PB/50 QTL 0
7
4
6
phân
(17)
bào
5-10 PB/50
0
4
0
1
QTL (5)
> 10 PB/50
1
6
0
3
QTL (10)

Bảng 3: Đặc điểm giải phẫu bệnh GIST có đột biến KIT trong nghiên cứu
STT

Mã số GPB

1

Y10-624

2


Y10-11239

3

Y10-11281

4

Y10-25033

5

S11-337

6

S11-1367

7

Y10-4510

8

Y10-26257

9

Y10-8341


10

Y10-10920

11

Vị trí đột
biến
Exon 9

Số
ca
1

3

Loại đột biến

Vị trí u

Y503_F504 ins AY

RN

Q556_V559 del

Kích thước Loại mô Phân Giai
(cm)
học

bào đoạn u
9
Thoi
21
KXD

RN

10

SPM

11

ĐT

TNAT
Cao

17

DCPM

Cao

Thoi

2

KKT


Cao

21

DBM

7

KKT

Cao

DD

3

HH

0

KT

Thấp

DD

8

Thoi


2

KKT

Trung bình

RN

20

Thoi

12

KKT

Cao

DD

6

Thoi

0

KKT

Trung bình


2

V559D

2

V560E

1

R586_N587ins14

RN

7

Thoi

4

KKT

Trung bình

1

Q549-V559 del

DD


18

Thoi

18

KKT

Cao

Y10-17769

1

Q556_E561 del

DD

4

DBM

0

KT

Thấp

12


Y10-19655

1

W557_V559 ins NP (del K558
ins NP)

MT

18

HH

5

DCG

Cao

13

Y10-19261

1

N566_P572 del

DD


14

Thoi

53

KKT

Cao

14

Y10-19656

1

W557C

DD

6

Thoi

5

KT

Trung bình


15

Y10-23494

1

N567_P577 del

ĐT

15

HH

11

KKT

Cao

16

Y10-23658

1

M552_K558 del

DD


7

Thoi

4

KT

Trung bình

17

Y10-24193

1

Y578_D579 ins DPPY

DD

7

Thoi

12

KT

Cao


18

Y10-7896

1

Phức tạp

RN

11

DBM

5

KKT

Cao

19

Y10-6182

RN

5

Thoi


3

KT

Thấp

20

Y10-9250

DD

4

Thoi

0

KT

Thấp

21

Y10-13755

MT

4


Thoi

0

KT

Thấp

22

Y10-3509

DD

11

Thoi

6

KKT

Cao

Exon 11

Exon 17

3


1

N822K

A794T

(DD: Dạ dày; RN: ruột non; ĐT: Đại tràng; MT: Mạc treo; DBM: Dạng biểu mô; HH: Hỗn hợp; TNAT: Tiềm năng ác
tính; KKT: Không khu trú; KT: Khu trú; DCPM: Di căn phúc mạc; DCG: Di căn gan)

Tương quan giữa tình trạng đột biến KIT
với đặc điểm lâm sàng và giải phẫu bệnh
Về mối tương quan giữa tình trạng đột biến
KIT với đặc điểm lâm sàng và giải phẫu bệnh

cũng như giá trị tiên lượng, sau khi tổng hợp
nhiều nghiên cứu khác nhau, tác giải Lasota có
bảng nhận xét như sau (Bảng 4)(13):

Bảng 4: Tổng hợp y văn các đặc điểm lâm sàng – giải phẫu bệnh của GIST liên quan tới đột biến KIT

Chuyên Đề Giải Phẫu Bệnh

71


Nghiên cứu Y học

Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011

Vị trí đột

biến

Đột biến ở mức độ
protein

Biểu hiện lâm sàng

Exon 9

Ala502_Tyr503dup

>90% đột biến kiểu này gặp ở
GIST của ruột non

Exon 11

Exon 13
Exon 17

Giá trị tiên lượng

Ưu thế loại tế Không có giá trị tiên lượng trong GIST
bào hình thoi
ruột

Trp557_Lys558del
Loại tế bào hình Biểu hiện ác tính hơn, đặc biệt là
Mất đoạn
GIST dạ dày
GIST ở mọi nơi trong ống tiêu hóa thoi và loại biểu

Mất đoạn-Chèn đoạn

Đột biến điểm
Biểu hiện ít ác tính hơn khi u ở dạ dày
Nhân đoạn
Thường là GIST dạ dày
Biểu hiện ít ác tính hơn khi u ở dạ dày
Biểu hiện ác tính nhiều hơn khi u ở dạ
Lys642Glu
GIST ở mọi nơi trong ống tiêu hóa Ưu thế loại tế
dày
bào hình thoi
Gặp trong GIST của ruột gấp hai
Asn822Lys
Không có giá trị tiên lượng
lần GIST ở nơi khác

Về đột biến KIT ở exon 11
Hiện nay, vẫn còn nhiều bất đồng về giá
trị tiên lượng của những đột biến KIT tại exon
11. Các nghiên cứu trước đây ghi nhận những
đột biến này thường gặp ở các GIST kích
thước lớn, có hoạt động phân bào mạnh, vì
vậy có mối liên quan với GIST ác tính. Tuy
nhiên, những nghiên cứu về sau ghi nhận đột
biến ở exon 11 có thể thấy ở cả GIST lành tính,
GIST phát hiện tình cờ và ác tính, do đó
không có mối liên quan rõ rệt giữa những đột
biến exon 11 và tiềm năng ác tính(7,13).
Theo Bảng 3, 17 ca đột biến exon 11 của

chúng tôi có 5 ca đột biến điểm và 12 ca không
phải đột biến điểm (mất đoạn, đảo đoạn, chèn
đoạn, đột biến phức tạp). Trong 5 ca đột biến
điểm, chỉ có 1 ca có tiềm năng ác tính cao, 4 ca
còn lại có tiềm năng ác tính thấp hoặc trung
bình. Ngược lại, 12 ca không phải đột biến điểm
chỉ có 3 ca có tiềm năng ác tính thấp hoặc trung
bình, còn lại 9 ca đều có tiềm năng ác tính cao.
Cũng theo Bảng 3, về đặc điểm giai đoạn u,
chúng tôi ghi nhận 5 ca đột biến điểm có 3 ca u
ở giai đoạn không khu trú (thủng tạng hoặc xâm
lấn cơ quan lân cận), 2 ca ở giai đoạn khu trú.
Trong 12 trường hợp không đột biến điểm chỉ
có 3 ca ở giai đoạn khu trú, 7 ca giai đoạn không
khu trú, 2 ca có di căn (1 ca di căn gan, 1 ca di
căn khắp phúc mạc thành bụng), nghĩa là những
trường hợp không phải đột biến điểm cũng có
xu hướng xâm lấn mạnh hơn.
Như vậy nghiên cứu của chúng tôi bước đầu
ghi nhận kết quả cũng khá phù hợp với y văn,

72

Loại mô học

đột biến điểm ở exon 11 có tiên lượng tốt hơn
các loại đột biến mất đoạn, chèn đoạn, đảo
đoạn.

Về đột biến KIT ở exon 9 và exon 17

Đa số các nghiên cứu trước đây đều cho
thấy tỷ lệ đột biến ngoài exon 11 rất thấp, chỉ
khoảng dưới 10%(12,18). Tuy nhiên, các nghiên
cứu cũng cho thấy sự phân bố tần suất các đột
biến có thể thay đổi theo chủng tộc. Đột biến
thêm 2 acid amin ở exon 9 (Y503-F504 ins AY)
hiếm gặp trong GIST của dạ dày ở bệnh nhân
Âu – Mỹ, nhưng tương đối thường gặp (32%) ở
bệnh nhân gốc châu Á(12). Trong nghiên cứu này,
chúng tôi chỉ phát hiện được 1 bệnh nhân có đột
biến của exon 9 (3,1%), không có bệnh nhân nào
đột biến ở exon 13, nhưng tỷ lệ đột biến exon 17
cao hơn hẳn các nghiên cứu khác (3 bệnh nhân
có đột biến N822K và 1 bệnh nhân có đột biến
A794T, 12,5%). Các số liệu bước đầu này gợi ý
rằng các đột biến gen trong ung thư của từng
quần thể khác nhau sẽ mang những đặc trưng
riêng biệt và cần được khảo sát thêm.

Về ý nghĩa của đột biến KIT với tình trạng
nhạy imatinib
Kể từ năm 2000, khi bệnh nhân GIST đầu
tiên được điều trị thành công với thuốc ức chế
tyrosine kinase là imatinib mesylate (Glivec,
Norvatis), nhiều bệnh nhân GISTs đã được điều
trị thành công với liệu pháp nhắm trúng đích
phân tử này(13). Tuy nhiên, đáp ứng điều trị với
imatinib còn phụ thuộc rất nhiều vào tình trạng
đột biến KIT (Bảng 5)(13).


Chuyên Đề Giải Phẫu Bệnh


Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011
Theo Bảng 5, chúng ta thấy ý nghĩa rất lớn
của việc giải trình tự gen KIT với hiệu quả của
liệu pháp nhắm trúng đích phân tử bằng
imatinib, cả về phương diện tiên đoán đáp ứng
điều trị và liều điều trị.
So với đột biến exon 11 thì đột biến exon 9
kém nhạy với imatinib hơn, nên liều điều trị
được khuyến cáo là 800 mg/ngày thay vì 400
mg/ngày, hoặc thay bằng sunitinib(5,18). Tuy
hiếm gặp, nhưng chẩn đoán đột biến exon 9
thật sự cần thiết trong quyết định điều trị
imatinib. Tỷ lệ đột biến cao ở exon 17 cũng
đáng chú ý trên bệnh nhân Việt Nam vì
N822K là đột biến kháng imatinib(9,13,15), bệnh
nhân cần được lựa chọn một mô thức điều trị
thích hợp khác ngoài loại thuốc này.
Bảng 5: Liên quan kiểu đột biến KIT với mức độ
nhạy imatinib trên thực nghiệm và đáp ứng với
imatinib trong điều trị theo các nghiên cứu thử
nghiệm lâm sàng của Mỹ và Châu Âu.
Exon Kiểu đột biến KIT (n) Mức độ nhạy imatinib
9
Ala502_Tyr503dup Nhạy với imatinib trên thực
nghiệm
Đáp ứng hoàn toàn (5%);
đáp ứng một phần (29%);

bệnh ổn định (47%), bệnh
tiến triển (17%) (nghiên cứu
pha III EORTC).
Liều cao gia tăng thời gian
lui bệnh
11
Mất đoạn/mất đoạn- Là những loại đột biến nhạy
chèn đoạn
imatinib thường gặp nhất
trên thực nghiệm
Đột biến điểm
Đột biến hiếm gặp Val559Ile
Nhân đoạn
kháng imatinib trên thực
nghiệm
Đáp ứng hoàn toàn (6%);
đáp ứng một phần (61%);
bệnh ổn định (25%), bệnh
tiến triển (3%) (nghiên cứu
pha III EORTC).
13
Lys642Glu (8)
Nhạy với imatinib trên thực
nghiệm
Glu635Lys (1)
Đáp ứng một phần hoặc
bệnh ổn định ở cả 9 ca
17
Asp820Tyr (1)
Asn822Lys và Asn822His nhạy

imatinib trên thực nghiệm
Asn822Lys (2)
Đáp ứng một phần (4 ca):
Asn822His (2)
Asn820Tyr, Asn822Lys,
Asn822His
Kháng imatinib nguyên
phát: Asn822Lys

Chuyên Đề Giải Phẫu Bệnh

Nghiên cứu Y học

Theo Bảng 5, GIST có KIT không đột biến
cũng có đáp ứng với điều trị imatinib nhưng
không hiệu quả bằng GIST có đột biến gen KIT
trên exon 11. Nghiên cứu của chúng tôi có 10
trường hợp KIT không đột biến, cần được khảo
sát thêm đột biến của gen PDGFRA. Các trường
hợp không có đột biến ở cả 2 gen được dự báo
đáp ứng không tốt với imatinib.

KẾT LUẬN
Đột biến KIT gặp trong 68,7% trường hợp
GIST và rất đa dạng, bao gồm các đột biến ở
exon 11 nhạy với imatinib và các đột biến ít
nhạy hoặc kháng imatinib ở ngoài exon 11. Giải
trình tự chuỗi DNA để khảo sát đột biến KIT
nên được thực hiện trước khi khởi đầu điều trị
imatinib cho bệnh nhân GIST.


TÀI LIỆU THAM KHẢO
1.

2.
3.

4.

5.

6.

7.

8.

9.

Andersson J, Sjogren H, Meis-Kindblom JM, Stenman G, Aman
P, Kindblom LG (2002). The complexity of KIT gene mutations
and chromosome rearrangements and their clinical correlation in
gastrointestinal stromal (pacemaker cell) tumors. Am J
Pathol;160(1):15-22.
Antonescu CR (2011). The GIST paradigm: lessons for other
kinase-driven cancers. J Pathol;223(2):251-61.
Biermann K, Goke F, Nettersheim D, Eckert D, Zhou H, Kahl P,
et al (2007). c-KIT is frequently mutated in bilateral germ cell
tumours and down-regulated during progression from
intratubular germ cell neoplasia to seminoma. J

Pathol;213(3):311-8.
Blanke CD, Rankin C, Demetri GD, Ryan CW, von Mehren M,
Benjamin RS, et al (2008). Phase III randomized, intergroup trial
assessing imatinib mesylate at two dose levels in patients with
unresectable or metastatic gastrointestinal stromal tumors
expressing the kit receptor tyrosine kinase: S0033. J Clin
Oncol;26(4):626-32.
Blay JY, von Mehren M, Blackstein ME (2010). Perspective on
updated treatment guidelines for patients with gastrointestinal
stromal tumors. Cancer;116(22):5126-37.
Cairoli R, Beghini A, Grillo G, Nadali G, Elice F, Ripamonti CB,
et al (2006). Prognostic impact of c-KIT mutations in core
binding factor leukemias: an Italian retrospective study.
Blood;107(9):3463-8.
Corless CL, McGreevey L, Haley A, Town A, Heinrich MC
(2002). KIT mutations are common in incidental gastrointestinal
stromal tumors one centimeter or less in size. Am J
Pathol;160(5):1567-72.
Gomes AL, Gouveia A, Capelinha AF, de la Cruz D, Silva P, Reis
RM, et al (2008). Molecular alterations of KIT and PDGFRA in
GISTs: evaluation of a Portuguese series. J Clin Pathol;61(2):2038.
Heinrich MC, Corless CL, Blanke CD, Demetri GD, Joensuu H,
Roberts PJ, et al (2006). Molecular correlates of imatinib

73


Nghiên cứu Y học

10.


11.

12.

13.

14.

74

Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 2 * 2011

resistance in gastrointestinal stromal tumors. J Clin
Oncol;24(29):4764-74.
Heinrich MC, Maki RG, Corless CL, Antonescu CR, Harlow A,
Griffith D, et al (2008). Primary and secondary kinase genotypes
correlate with the biological and clinical activity of sunitinib in
imatinib-resistant gastrointestinal stromal tumor. J Clin
Oncol;26(33):5352-9.
Hoei-Hansen CE, Kraggerud SM, Abeler VM, Kaern J, RajpertDe Meyts E, Lothe RA (2007). Ovarian dysgerminomas are
characterised by frequent KIT mutations and abundant
expression of pluripotency markers. Mol Cancer;6:12.
Lasota J, Miettinen M (2006). KIT and PDGFRA mutations in
gastrointestinal stromal tumors (GISTs). Semin Diagn
Pathol;23(2):91-102.
Lasota J, Miettinen M (2008). Clinical significance of oncogenic
KIT and PDGFRA mutations in gastrointestinal stromal
tumours. Histopathology;53(3):245-66.
Lasota J, Wozniak A, Sarlomo-Rikala M, Rys J, Kordek R, Nassar

A, et al (2000). Mutations in exons 9 and 13 of KIT gene are rare
events in gastrointestinal stromal tumors. A study of 200 cases.
Am J Pathol;157(4):1091-5.

15.

16.

17.

18.

19.

Liegl B, Kepten I, Le C, Zhu M, Demetri GD, Heinrich MC, et al
(2008). Heterogeneity of kinase inhibitor resistance mechanisms
in GIST. J Pathol;216(1):64-74.
Miettinen M, Makhlouf H, Sobin LH, Lasota J (2006).
Gastrointestinal stromal tumors of the jejunum and ileum: a
clinicopathologic, immunohistochemical, and molecular genetic
study of 906 cases before imatinib with long-term follow-up. Am
J Surg Pathol;30(4):477-89.
Nguyễn Duy Phúc, Phạm Xuân Dũng, Trần Nguyên Hà,
Nguyễn Diệp Kiều Hạnh (2010). Khảo sát hiệu quả và an toàn
của imatinib mesylate trong điều trị bướu mô đệm đường tiêu
hóa tái phát, di căn: cập nhật sau 3 năm điều trị. Y học TP. Hồ
Chí Minh;14(4):239-246.
Pierotti MA, Tamborini E, Negri T, Pricl S, Pilotti S (2011).
Targeted therapy in GIST: in silico modeling for prediction of
resistance. Nat Rev Clin Oncol;8(3):161-70.

Sakurai S, Oguni S, Hironaka M, Fukayama M, Morinaga S,
Saito K (2001). Mutations in c-kit gene exons 9 and 13 in
gastrointestinal stromal tumors among Japanese. Jpn J Cancer
Res;92(5):494-8.

Chuyên Đề Giải Phẫu Bệnh



×