Tải bản đầy đủ

Phát triển kỹ thuật multiplex real time PCR sử dụng taqman probe cải tiến để phát hiện HPV nguy cơ thấp type 6 và 11 với độ đặc hiệu và độ nhạy cao

TẠP CHÍ NGHIÊN CỨU Y HỌC

PHÁT TRIỂN KỸ THUẬT MULTIPLEX REAL TIME PCR SỬ DỤNG
TAQMAN PROBE CẢI TIẾN ĐỂ PHÁT HIỆN HPV NGUY CƠ THẤP
TYPE 6 VÀ 11 VỚI ĐỘ ĐẶC HIỆU VÀ ĐỘ NHẠY CAO
Trần Thị Ngọc Ánh1,2#, Ngô Thị Hồng1,2,3#, Chu Văn Sơn1,
Trần Dụ Chi4,5, Bùi Thị Việt Hà1,2, Nguyễn Thị Vân Anh1*
*Tác giả liên hệ; #:Đồng tác giả thứ nhất
Phòng Thí nghiệm trọng điểm Công nghệ Enzyme và Protein, Trường Đại học Khoa học Tự nhiên,

1

Đại học Quốc gia Hà Nội; 2Khoa Sinh học, Trường Đại học Khoa học Tự nhiên, Đại học Quốc Gia Hà Nội
3
Trung tâm Kiểm soát bệnh tật tỉnh Bắc Ninh, Thành phố Bắc Ninh
4
Bệnh viện Da liễu Trung ương; 5Bệnh viện Đa khoa Quốc tế Vinmec
Human papillomavirus (HPV) là tác nhân gây bệnh phổ biến lây nhiễm qua đường tình dục, gồm nhiều
sub-type được phân thành nhóm nguy cơ cao gây ung thư và nhóm nguy cơ thấp gây các bệnh lý về da và
niêm mạc với tỷ lệ nhiễm và khả năng tái phát cao. Trên thị trường đã có sinh phẩm nhập ngoại để phát hiện
một số type Human papillomavirus nguy cơ thấp, tuy nhiên giá thành cao nên khó triển khai thành kít sàng

lọc trong cộng đồng. Trong nghiên cứu này, chúng tôi xây dựng phương pháp mới với chi phí thấp hơn, giúp
phát hiện 2 type Human papillomavirus nguy cơ thấp thường gặp nhất là Human papillomavirus 6 và Human
papillomavirus 11 với độ nhạy 5 copy/phản ứng 25 µL bằng kỹ thuật multiplex real time PCR sử dụng
Taqman probe cải tiến có gắn thêm ZEN quencher gần đầu 5-huỳnh quang HEX, song song với phát hiện
gen nội chuẩn β-actin bằng Texas-Red Taqman probe. Kết quả so sánh trên 30 mẫu dịch âm đạo với sinh
phẩm thương mại có uy tín cho kết quả tương đồng về tỷ lệ mẫu dương tính và chu kỳ ngưỡng phát hiện
Human papillomavirus 6/11.
Từ khoá: HPV, nguy cơ thấp, real time PCR Taqman, dịch âm đạo

I. ĐẶT VẤN ĐỀ
Human papiloma virus (HPV) là một trong
những tác nhân gây bệnh quan trọng lây
nhiễm qua đường tình dục ở cả nam và nữ
trên toàn thế giới và được cho là bệnh truyền
nhiễm qua đường tình dục phổ biến nhất ở
Hoa Kỳ [1]. Các type Human papillomavirus
16 và 18 và 12 type khác như 31, 33, 35, 39,
45, 51, 52, 56, 58, 59, 66, 68 đã được nghiên
cứu và chứng minh có nguy cơ cao gây bệnh
ung thư cổ tử cung [2,3,4]. Ngoài các type có
nguy cơ cao, một số type nguy cơ thấp được
Địa chỉ liên hệ: Nguyễn Thị Vân Anh, Trường Đại học
Khoa học Tự nhiên

công nhận là nguyên nhân gây ra các tổn
thương lành tính trên da (mụn cơm, mụn cóc
thông thường, mụn cơm phẳng). Hai type
HPV nguy cơ thấp 6 và 11 là nguyên nhân
của 90% các bệnh lý về da [5]. Nhiễm trùng
papillomatosis chủ yếu gặp ở trẻ nhỏ được
sinh ra từ những bà mẹ có tiền sử nhiễm HPV
trong giai đoạn chu sinh [6 - 8]. Những tổn
thương này có thể chuyển đổi thành ác tính
[9]. Nhiễm trùng HPV thường không biểu hiện
lâm sàng nên không thể có thống kê chính xác
số lượng người nhiễm trên toàn thế giới. Ước
tính trên thế giới, hàng năm, HPV gây ra mụn
cóc sinh dục cho 0,1 - 0,2% dân số, chủ yếu ở

Email: vananhbiolab@gmail.com



tuổi vị thành niên, thanh thiếu niên [10]. Các

Ngày nhận: 30/7/2018

type này rất dễ lây truyền qua tiếp xúc (da,

Ngày được chấp thuận: 04/9/2018

niêm mạc, dịch tiết có virus). Do đó, việc chẩn

TCNCYH 115 (6) - 2018

61


TẠP CHÍ NGHIÊN CỨU Y HỌC
đoán sàng lọc tại cộng đồng HPV 6 và 11

VNĐ/ phản ứng) nên khó khăn khi triển khai

cũng góp phần quan trọng để phòng tránh lây

thành xét nghiệm sàng lọc tại cộng đồng. Ở

nhiễm, đặc biệt là cho trẻ sơ sinh. Hiện nay,

trong nước, chúng tôi chưa tìm thấy thông tin

phương pháp hiệu quả nhất để chẩn đoán

về nghiên cứu phát triển phương pháp hay bộ

HPV là dựa vào vật liệu di truyền (kỹ thuật

sinh phẩm phát hiện các type HPV nguy cơ

PCR/real time PCR). Trên thế giới, đã có công

thấp mà mới chỉ có thông tin về các bộ sinh

bố của một vài tác giả về phát triển kỹ thuật

phẩm phát hiện các type HPV nguy cơ cao.

multiplex real time PCR để phát hiện đồng

Do vậy, trong nghiên cứu này, chúng tôi đặt

thời một số type nguy cơ cao và nguy cơ thấp

mục tiêu bước đầu phát triển phương pháp

trong sàng lọc HPV ở các mẫu dịch âm đạo.

multiplex real time PCR sử dụng Taqman

Điển hình là công bố của tác giả Lindh và

probe cải tiến gắn thêm ZEN quencher để

cộng sự (2007) về phát hiện 12 type HPV

phát hiện 2 type HPV nguy cơ thấp thường

nguy cơ cao và 2 type nguy cơ thấp HPV 6/11

gặp nhất là HPV 6 và HPV 11 có độ đặc hiệu

đồng thời trên cùng một chu trình nhiệt [11].

100% và độ nhạy đạt tới ≤ 5 copy phản ứng

Tuy nhiên, hạn chế của nghiên cứu là sử

25 µL. Kết quả của nghiên cứu là tiền đề cho

dụng Taqman probe thông thường có huỳnh

việc phát triển phương pháp phát hiện đồng

quang TAMRA ở đầu 3’ nên tín hiệu nền còn

thời các type HPV nguy cơ cao và nguy cơ

cao và chưa tối ưu được master mix để phát

thấp trong tương lai, hướng tới việc chế tạo

hiện của 14 type trong cùng 1 ống phản ứng

bộ sinh phẩm có chất lượng tương đương và

mà vẫn phải thực hiện 14 ống phản ứng riêng

giá thành cạnh tranh so với bộ sinh phẩm

rẽ cho mỗi mẫu. Một hạn chế khác là chưa có

thương mại có uy tín trên thị trường. Nhờ đó,

thông tin tối ưu về độ nhạy và độ đặc hiệu của

góp phần tầm soát tỷ lệ nhiễm HPV và đánh

phản ứng. Nghiên cứu của tác giả Seaman và

giá hiệu quả vacxin.

cộng sự (2010) có cải tiến hơn trong việc phát
triển được kỹ thuật multiplex real time PCR
phát hiện đồng thời HPV 16, 18 và 2 type HPV
nguy cơ thấp 6, 11 [12]. Tuy nhiên, độ nhạy
của ngưỡng phát hiện chỉ đạt 103 copy/phản
ứng 25 µL, một phần do sử dụng Taqman

II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP
1. Đối tượng
Mẫu tham chiếu dùng để xây dựng
phương pháp:

probe thông thường có BHQ1 quencher ở đầu

+ Mẫu HPV: các mẫu DNA được tinh sạch

3’. Tác giả Yu và cộng sự (năm 2012) đã sử

và xác định dương tính với các HPV

dụng probe huỳnh quang AllGlo để phát hiện

genotypes khác nhau. Trong đó có 14 type

đồng thời 4 type HPV 6, 11, 16, 18 với độ

HPV nguy cơ cao phổ biến (HPV 16, 18, 31,

nhạy 10 copy/phản ứng 25 µL [13]. Trên thị

33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68) do

trường có bộ kít phát hiện HPV type 6 và 11

bệnh viện Phụ Sản Trung ương cung cấp đã

nguy cơ thấp HPV 6/11 Real-TM (Sacace

được xác định đồng thời bằng kit thương mại

Biotechnologies, Ý) có độ nhạy đạt tới 2,5

Real time Cobas®HPV test của hãng Roche

copy/phản ứng 25 µL nhưng thành phần và

Diagnostics - Thuỵ Sỹ và GenoFlow human

công thức chưa được công bố. Ngoài ra, giá

papillomavirus array test (GF test) của hãng

thành sinh phẩm nhập ngoại cao (178.000

Diagcor - Hồng Kông và có 2 type nguy cơ

62

TCNCYH 115 (6) - 2018


TẠP CHÍ NGHIÊN CỨU Y HỌC
thấp (HPV 6, 11) do bệnh viện Da liễu Trung

Mẫu thử nghiệm: Mẫu bệnh phẩm (n = 95)

ương cung cấp đã được xác định đồng thời

được lấy từ dịch âm đạo của bệnh nhân và

GF test (Diagcor – Hồng Kông) và HPV 6/11

được bảo quản trong dung dịch nước muối

Real-TM của hãng Saccase – Ý. Các mẫu

sinh lý đã khử trùng. Mẫu được sử dụng ngay

được lựa chọn có giá trị chu kỳ ngưỡng (Ct)

để tách chiết DNA tổng số và DNA được sử

≤ 32 để đảm bảo nồng độ DNA ≥ 10 copies/µ

dụng ngay hoặc được bảo quản ở -80oC trước

l, tương đương với nồng độ chuẩn dương hay

khi tiến hành real time PCR. Mẫu được thu

được sử dụng trong các kit thương mai. DNA

thập theo phương pháp chọn mẫu thuận tiện,

của các mẫu tham chiếu được sử dụng làm

tại Trung tâm kiểm soát bệnh tật tỉnh Bắc Ninh

khuôn để nhân bản trình tự đặc hiệu bằng

từ năm 2017 đến 2018. Tiêu chuẩn lựa chọn

PCR sử dụng cặp mồi GP5+/6+ (theo khuyến

bệnh nhân là phụ nữ trong độ tuổi từ 18 - 65

cáo của CDC) và giải trình tự DNA để khẳng

tuổi, đến khám và tự nguyện tham gia nghiên

định type.

cứu; tiêu chuẩn loại trừ là những bệnh nhân

3

+ Mẫu nhiễm các vi sinh vật gây bệnh
khác: các mẫu DNA dương tính với các tác
nhân gây bệnh bao gồm: Hepatitis B virus
(HBV), Hepatitis C virus (HCV), Human
Simplex

virus

cytomegalovirus

type

1

(CMV),

-

2

(HSV),

Mycobacterium

tuberculosis (MTB), Epstein - Barr virus (EBV),
Mycoplasma hominis, Mycoplasma genitalium
do Bệnh viện Bạch Mai, Học Viện Quân Y và
Bệnh viện Da liễu Trung ương cung cấp. Mẫu
HBV, HCV và HSV type 1 - 2 được xác định
bằng các kít thương mại (Real time PCR
Cobas®HBV test, Real time PCR Cobas®HCV
test, Cobas®HSV 1 and 2 test của hãng Roche
Diagnostics - Thuỵ Sỹ; mẫu CMV được xác
định bởi Real time PCR ANAPURE® CMV

đã cắt cổ tử cung hoàn toàn, đang trong thời
kỳ kinh nguyệt, viêm nhiễm nặng và đang đặt
thuốc. Nghiên cứu được phê duyệt bởi hội
đồng khoa học, trên cơ sở quyết định số
1124/QĐ-ĐHKHTN của Trường Đại học Khoa
học Tự nhiên, và được thực hiện theo đúng
đạo đức nghiên cứu trong Y học. Bệnh nhân
được cung cấp đầy đủ thông tin về nghiên
cứu, được bảo mật thông tin cá nhân và ký
vào phiếu đồng thuận tham gia nghiên cứu.
2. Phương pháp
2.1. Thiết kế primer và probe cho phản
ứng real time PCR phát hiện đồng thời type
HPV 6 và HPV 11
Hai cặp mồi và probe sử dụng trong nghiên

bởi

cứu này được thiết kế sử dụng IDT’s

ANAPURE MTB qPCR, mẫu EBV được xác

PrimerQuest kết hợp với phần mềm SnapGen

qPCR,

mẫu

MTB

được

xác

định

®

định bởi ANAPURE EBV qPCR, ANAPURE ,

version 4.1.3 dựa vào trình tự vùng gen E6-E7

mẫu M. hominis và M. genitalium được xác

đặc

định đồng thời bởi Mycoplasma homi-geni

HG793938.1), trình tự vùng gen E1 đặc hiệu

qPCR của hãng ANABIO R&D - Vietnam, và

cho HPV 11 (Acession No. JQ773411.1) được

Diagcor STD array test - Hồng Kông). Các

công bố trên ngân hàng gen NCBI. Hai trình

mẫu được lựa có giá trị Ct thấp nhất có thể và

tự probe đặc hiệu cho HPV 6 và HPV 11 được

đạt yêu cầu Ct ≤ 32, để đảm bảo nồng độ DNA

cải tiến gắn thêm ZEN quencher dye tại

của các vi sinh vật nhiễm được sử dụng là

oligonucleotide thứ 9 gần đầu 5’-huỳnh quang

khá cao, tối thiểu là 103 copies/µl.

HEX để tăng khả năng hấp thụ hay dập tắt tín

®

TCNCYH 115 (6) - 2018

®

hiệu

cho

HPV

6

(Acession

No.

63


TẠP CHÍ NGHIÊN CỨU Y HỌC
hiệu của HEX khi probe chưa gắn vào khuôn,

theo công bố của Nguyen và cộng sự [14].

nhờ đó tín hiệu nền giảm và độ nhạy của phản

Mồi và probe được tổng hợp bởi hãng IDT

ứng được tăng lên. Cặp mồi và probe đặc

(Hoa Kỳ) và được trình bày ở bảng 1.

hiệu cho human β-actin (ACTB) được thiết kế
Bảng 1. Các cặp mồi và probe đặc hiệu cho HPV 6 và HPV 11
Mồi/

Gen

Trình tự (5’ - 3’)

mẫu dò

đích

Kích
thước

Lượng
(pmol/

(bp)

pứ)

6-Fw

CCGCTGTGTGAAGTAGAAAAGGTAAA

6-Rv

CTACAGGGTCTGGAGGTTGC

6-HEX
probe

/5HEX/AAGGGTCGC/ZEN/TGCCTACACTGCT
GG/3IABkFQ/

1

11-Fw

GCAAGTACAGTTATAGGGGAGG

5

11-Rv

GTCAAAGTCTCCACGCTG

11-HEX
probe

/5HEX/CGGAATGG A/ZEN/TAAC GCGCCA
GACCG/3IABkFQ/

1

ACTB-Fw

GATGTCCACGTCACACTTCA

3

ACTB-Rv

ATGCCTGAGAGGGAAATGAGGGC

3

ACTBTexas

/5TexasRed/ATGCCTGAGAGGGAAATGAGG

probe

5
E6, E7

165

174

E1

β-actin

5

5

115
2

GC/3BHQ2/

2.2. Tách chiết DNA của HPV và nhân

HPV 11. Thành phần phản ứng PCR gồm 1X

dòng tạo chuẩn dương chứa trình tự đặc
hiệu của HPV 6 và HPV 11

Hot - Taq Buffer; 0,2 mM dNTP; 1U Hot - Taq;

DNA tổng số của virus được tách chiết từ

Phản ứng PCR được thực hiện với chế độ

mẫu bệnh phẩm dịch âm đạo sử dụng bộ sinh

nhiệt 950C - 5 phút; 45 chu kỳ gồm các bước:

phẩm ANAPURE VIRAL DNA/RNA mini kit

950C - 30 giây, 600C - 30 giây, 720C - 30 giây;

(ANABIO R & D, Việt Nam) theo hướng dẫn

720C - 5 phút. Các sản phẩm PCR được kiểm

của nhà sản xuất, sau đó được lưu trữ ở -

tra bằng điện di trên gel agarose 2%, nhuộm

20oC cho các phản ứng PCR và real time

Ethidium bromide và chụp ảnh bằng hệ thống

PCR. DNA sau tinh sạch từ mẫu tham chiếu

Gel Doc XR (Biorad).

400 nM 6/11 Rv/Fw và H2O cho thể tích 25 µl.

dương tính HPV 6 và HPV 11 được sử dụng

Sản phẩm PCR 165 bp đặc hiệu cho HPV

làm khuôn cho phản ứng PCR nhân bản trình

6 và 174 bp đặc hiệu cho HPV 11 được nhân

tự gen đặc hiệu E6 - E7 và E1 kích thước

dòng trực tiếp vào vector pTOP sử dụng bộ

tương ứng 165 bp và 174 bp của HPV 6 và

sinh phẩm TOPcloner ™ TA Kit (Enzynomics,

64

TCNCYH 115 (6) - 2018


TẠP CHÍ NGHIÊN CỨU Y HỌC
Hàn Quốc). Plasmid tái tổ hợp mang đoạn
chèn 165 bp và 174 bp được được biến nạp
vào E. coli DH5 α, sau đó nuôi cấy trên môi
trường LB đặc bổ sung ampicillin 50 mg/L, rồi
tiến hành chọn lọc khuẩn lạc xanh-trắng và
sàng lọc bằng colony - PCR sử dụng cặp mồi
vector M13 - Fw/Rv (đi kèm bộ sinh phẩm) và
mồi đặc hiệu 6, 11 - Fw/Rv. Khuẩn lạc tái tổ
hợp được sử dụng để tách plasmid để làm
chuẩn dương cho phản ứng real time PCR
phát hiện HPV 6 và HPV 11 và được đặt tên
tương ứng là pHPV6 - E6/7 và pHPV11 - E1.

2.4. Xác định độ đặc hiệu
Độ đặc hiệu của multiplex real time PCR
nêu trên được đánh giá thông qua kết quả
dương tính giả (nếu có) khi sử dụng 5 µl DNA
mỗi khuôn ở nồng độ tối thiểu là 103 copies/µl
của 14 type HPV nguy cơ cao phổ biến gồm
HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58,
59, 66, 68, và của một số vi sinh vật gây bệnh
truyền nhiễm khác gồm HBV, HCV, HSV,
CMV, MTB, EBV, Mycoplasma hominis, M.
genitalium bổ sung vào hỗn hợp 20 µl master
mix có thành phần được mô tả trong mục 2.3.

2.3. Xác định ngưỡng phát hiện của

Phản ứng được thực hiện với chu trình nhiệt

phản ứng và tối ưu nồng độ của chuẩn

giống như áp dụng cho type HPV 6 và 11,

dương

được mô tả trong mục 2.3.

Plasmid tái tổ hợp pHPV6-E6/7 và pHPV11

2.5. Thử nghiệm phát hiện HPV 6 và

- E1 sau khi tinh sạch được xác định nồng độ
ở bước sóng 260 nm bằng máy quang phổ

HPV 11 trên mẫu bệnh phẩm và so sánh độ
tương đồng với sinh phẩm thương mại

Nanodrop. Xác định ngưỡng phát hiện của

Tổng cộng 95 mẫu được sử dụng để thử

kỹ thuật multiplex real time PCR bằng cách

nghiệm phát hiện HPV 6 và HPV 11 bởi
master mix chế tạo và chu trình nhiệt thiết lập

pha loãng nồng độ khuôn plasmid pHPV6 E6/7, pHPV11 - E1 và hỗn hợp 2 plasmid tỷ lệ
1: 1 ở dải nồng độ 103, 102, 10, 1 copies/µl.

trong nghiên cứu này. Trong đó, 30 mẫu gồm
10 mẫu dương tính và 20 mẫu âm tính với

5 µl DNA khuôn được bổ sung vào 20 µl mas-

HPV 6 và 11 được sử dụng để so sánh tương

ter mix của multiplex real time PCR gồm: TO-

đồng (tỷ lệ dương tính/âm tính) và độ nhạy
(Ct) giữa sinh phẩm tạo thành trong nghiên

Preal

Taqman

PCR

master

mix

1X

11- Rv/ Fw; 50 nM 6, 11 - HEX probe; 150 nM

cứu và sinh phẩm thương mại HPV 6/11
REAL-TM (Sacace Biotechnologies, Ý).

ACTB Rv/Fw; 100 nM ACTB- probe và H2O để

Toàn bộ thí nghiệm từ mục 2.1 đến 2.4

đạt tổng thể tích là 25 µl. Phản ứng được thực

được thực hiện tại Phòng Thí nghiệm trọng

(Enzynomics); 250 nM 6, 11 - Rv/Fw; 250 nM

0

hiện với chu trình nhiệt là 95 C - 10 phút;
o

0

điểm Công nghệ Enzym và Protein, Trường

45 chu kỳ gồm 95 C - 10 giây; 60 C - 45 giây

Đại học Khoa học Tự nhiên từ năm 2017 đến

trên hệ thống Light Cycler 96 (Roche Diagnos-

2018. Thí nghiệm ở mục 2.5 được thực hiện

tics). Ngưỡng phát hiện là nồng độ thấp nhất

tại cả Khoa Xét nghiệm - Chẩn đoán hình ảnh

của chứng dương pHPV6 - E6/7 và pHPV11 -

- Thăm dò chức năng của Trung tâm Kiểm

E1 trong ống phản ứng mà vẫn phát hiện

soát Bệnh tật tỉnh Bắc Ninh và Phòng Thí

được tín hiệu huỳnh quang với giá trị Ct < 40,

nghiệm Trọng điểm Công nghệ Enzym và

được tính bằng giá trị copies/µl DNA khuôn

Protein, Trường Đại học Khoa học Tự nhiên

đầu vào x 5).

trong năm 2018.

TCNCYH 115 (6) - 2018

65


TẠP CHÍ NGHIÊN CỨU Y HỌC

III. KẾT QUẢ
1. Vector mang chuẩn dương HPV 6 và
HPV 11

Quốc) và khuẩn lạc tái tổ hợp được khẳng
định bằng phương pháp colony - PCR sử
dụng cặp mồi vector M13 - Fw/Rv (đi kèm bộ
sinh phẩm) và mồi đặc hiệu 6, 11 - Fw/Rv. Kết

Trong nghiên cứu này, đoạn gen đặc hiệu

quả trình bày trên hình ảnh điện di ở giếng 6

cho vùng E6 - 7 của HPV 6 có kích thước 165

(hình 1B) và giếng 2 (hình 1C) cho thấy kích

bp và đoạn gen đặc hiệu cho vùng E1 của

thước băng điện di là 165 bp và 174 bp đúng

HPV 11 có kích thước 174 bp được khuếch

với kích thước đoạn gen đặc hiệu của vector

đại bằng phản ứng PCR với cặp mồi đặc hiệu.

tái tổ hợp HPV6 - E6/7 và HPV11 - E1. Để

Kết quả trình bày ở Hình 1A cho thấy: sản

khẳng định chắc chắn khuẩn lạc tái tổ hợp

phẩm PCR với cặp mồi 6 - Fw và 6 - Rv cho

chứa gen đặc hiệu của HPV 6 và HPV 11,

duy nhất một băng sắc nét với kích thước

chúng tôi sử dụng cặp mồi vector M13 Rv/Fw

tương ứng là 165 bp (giếng 3); tương tự, sản
phẩm PCR với cặp mồi HPV 11 cho một băng
rõ nét có kích thước 174 bp (giếng 4). Hai
băng này sau đó được tinh sạch và đem giải
trình tự. Kết quả giải trình tự trùng khớp với
trình tư gen E6-7 của HPV 6 và trình tự gen
E1 của HPV 11 (không trình bày ở đây).

cho kích thước đoạn gen khuếch đại được
bằng tổng kích thước đoạn gen mồi M13 nhân
lên (202 bp) cộng với kích thước đoạn gen
đích. Như vậy, kích thước tính toán về mặt lý
thuyết khi sử dụng mồi vector cho đoạn gen
đích HPV 6 và HPV 11 lần lượt là 367 bp và
376 bp. Đúng như dự đoán, kết quả thể hiện
trên hình 1B (giếng 2 - 4) hình 1C (giếng 4 - 6)

Sản phẩm PCR sau đó được nhân dòng

cho thấy chúng tôi đã nhân dòng thành công

vào vector pTOP TA V2 sử dụng bộ sinh

plasmid tái tổ hợp pHPV6-E6/7 và pHPV11 -

phẩm TOPcloner™ TA Kit (Enzynomics, Hàn

E1.

Hình 1. Kết quả điện di sản phẩm PCR nhân bản đoạn gen đặc hiệu HPV6-E6/7 và HPV11E1 (A) và kiểm tra sản phẩm sau nhân dòng (B, C)
(A): Giếng 1: Thang chuẩn DNA 100 bp, giếng 2: Đối chứng âm, giếng 3: sản phẩm PCR của
HPV6 - E6/7, giếng 4: sản phẩm PCR của HPV11 - E1; (B): Giếng 1: Đối chứng âm, giếng 2 - 4:
Sản phẩm PCR mồi vector M13, giếng 5: Thang chuẩn DNA 100 bp, giếng 6: sản phẩm PCR sử
66

TCNCYH 115 (6) - 2018


TẠP CHÍ NGHIÊN CỨU Y HỌC
dụng mồi đặc hiệu Fw/Rv - 6; (C): Giếng 1: Đối chứng âm, giếng 4 - 6: Sản phẩm PCR sử dụng
mồi vector M13, giếng 3: Thang chuẩn DNA 100 bp, giếng 2: sản phẩm PCR sử dụng mồi đặc
hiệu Fw/Rv - 11.
2. Ngưỡng phát hiện HPV 6 và HPV 11 bằng multiplex real time PCR
Kết quả đánh giá ngưỡng phát hiện của kỹ thuật multiplex real time PCR phát hiện đồng thời
cả HPV 6 và HPV 11 thể hiện ở hình 2 cho thấy tất cả các nồng độ của chứng dương ở dạng
đơn lẻ (hình 2A - B) hay hỗn hợp (hình 2C) đều cho kết quả dương tính, giá trị Ct ở các nồng độ
pha loãng từ cao đến thấp giảm trung bình 3,2. Ngưỡng phát hiện HPV 6 của phản ứng lên tới 5
copy/phản ứng (1 copy/µl DNA đầu vào x 5 µl khuôn/phản ứng 25 µl) với giá trị R2: 0,993,
Efficiency: 93%, slope: -3,34. Tương tự, ngưỡng phát hiện HPV 11 là 5 copy/phản ứng (R2:
0,998, Efficiency: 85%, slope: -3,7) và đồng thời HPV 6,11 cũng lên tới 5 copy/phản ứng (R2:
0,999, Efficiency: 80%, slope: -3,99). Dựa trên kết quả này, ngưỡng phát hiện của kỹ thuật
multiplex real time PCR phát hiện đồng thời 2 tác nhân gây bệnh HPV6, 11 được xác định là 5
copy/phản ứng 25 µl (tương đương nồng độ DNA khuôn 1 copy/µl).

Hình 2. Đường chuẩn biểu diễn tín hiệu huỳnh quang của phản ứng Real time PCR
và đường hồi quy tuyến tính giá trị chu kỳ ngưỡng ở các dải nồng độ chuẩn dương
khác nhau: (A1, B1, C1)
TCNCYH 115 (6) - 2018

67


TẠP CHÍ NGHIÊN CỨU Y HỌC
Đường chuẩn Real time PCR biểu diễn tín hiệu khuếch đại chuẩn dương HPV 6 (A1), HPV 11
(B1) và hỗn hợp HPV 6, 11 (C1) ở nồng độ 103, 102, 10,1 copy/µl; (A2, B2, C2). Đường hồi quy
tuyến tính giữa giá trị chu kỳ ngưỡng Ct và nồng độ chuẩn dương HPV 6 (A2), HPV 11 (B2) và
hỗn hợp HPV 6, 11 (C2).
3. Độ đặc hiệu của multiplex real time PCR phát hiện HPV 6 và HPV 11
Để xác định độ đặc hiệu của real time PCR phát hiện HPV 6 và HPV 11, chúng tôi sử dụng 20
mẫu DNA dương tính với các type HPV nhóm nguy cơ cao (HPV 16, 18, 31, 33, 35, 39, 45, 51,
52, 56, 58, 59, 66, 68) và một số tác nhân khác (HBV, HCV, HSV, CMV, MTB, EBV, Mycoplasma
hominis, Mycoplasma genitalium) đã được mô tả ở phần mẫu tham chiếu, làm DNA khuôn cho
multiplex real time PCR với cặp mồi và probe đã thiết kế cho HPV type 6 và 11. Kết quả ở Bảng 2
cho thấy sinh phẩm chế tạo trong nghiên cứu cho kết quả âm tính với các tác nhân gây bệnh
tham chiếu này ở nồng độ > 103 copies/µl, chứng tỏ độ đặc hiệu của kỹ thuật là 100%.
Bảng 2. Kết quả thử nghiệm độ đặc hiệu của bộ sinh phẩm với một số tác nhân gây bệnh
STT

Tác nhân vi sinh vật gây bệnh

Kết quả

1

HPV nhóm nguy cơ cao gồm các type 16, 18, 31, 33, 35, 39,
45, 51, 52, 56, 58, 59, 66, 68

Âm tính

2

HBV (Hepatitis B Virus)

Âm tính

3

HCV (Hepatitis C Virus)

Âm tính

4

HSV (Herpes Simplex Virus) type 1, 2

Âm tính

5

CMV (Cytomegalovirus)

Âm tính

6

MBT (Mycobacterium tuberculosis)

Âm tính

7

EBV (Epstein - Barr Virus)

Âm tính

8

Mycoplasma hominis

Âm tính

9

Mycoplasma genitalium

Âm tính

4. Khả năng phát hiện sự có mặt của virus HPV6, 11 của master mix và đánh giá mức
độ tương đồng của kỹ thuật phát triển với bộ sinh phẩm thương mại
Sử dụng DNA tách chiết từ mẫu dịch phết âm đạo của 95 bệnh nhân đến khám tại Trung tâm
Kiểm soát bệnh tật tỉnh Bắc Ninh để đánh giá khả năng phát hiện sự có mặt của HPV 6 và HPV
11 bởi master mix chế tạo trong nghiên cứu này (thành phần được mô tả ở mục nguyên liệu và
phương pháp, kết quả bảng 1, tạm đặt tên là HPV6/11 - KLEPT), chúng tôi phát hiện thấy có
10/95 (10,5%) mẫu dương tính với một trong 2 type HPV 6/11 (bảng 3).

68

TCNCYH 115 (6) - 2018


TẠP CHÍ NGHIÊN CỨU Y HỌC
Bảng 3. Kết quả phát hiện HPV 6 và HPV 11 trên các mẫu thử nghiệm bằng master mix
chế tạo trong nghiên cứu và sinh phẩm thương mại
HPV6/11 - KLEPT

HPV 6/11 REAL-TM

Tổng số

Kit (Sacace)

Dương tính

Âm tính

Dương tính

10

0

10

Âm tính

0

20

20

Tổng số

10

20

30

Trong số 95 mẫu này, 10 mẫu bệnh phẩm dương tính và ngẫu nhiên 20 mẫu bệnh phẩm âm
tính (tổng cộng n = 30) được chọn để so sánh tương đồng giữa master mix HPV 6/11 - KLEPT
với bộ sinh phẩm thương mại đạt chuẩn IVD châu Âu có tên HPV 6/11 REAL-TM Kit (Sacace
Biotechnologies, Ý). Kết quả thể hiện ở bảng 4 cho thấy tín hiệu dương tính của master mix HPV
6/11 - KLEPT chế tạo trong nghiên cứu (10 mẫu tín hiệu HEX cho cả HPV type 6/11) và của bộ
kit thương mại (FAM cho 6 mẫu HPV type 6 và HEX cho 4 mẫu HPV type 11) chênh lệch không
quá 1 giá trị Ct. Kết quả so sánh bước đầu trên 30 mẫu cho thấy master mix HPV 6/11 - KLEPT
có chất lượng tương đương với bộ sinh phẩm thương mại HPV 6/11 REAL - TM Kit (Sacace, Ý).
Bảng 4. Giá trị chu kỳ ngưỡng của phản ứng real time PCR phát hiện 10 bệnh nhân
dương tính HPV 6 /11 bằng master mix trong nghiên cứu so sánh với sinh phẩm thương mại

STT

HPV6/11KLEPT

HPV 6/11 Real - TM

HPV 6/11
Real-TM

Ct HEX
(HPV 6/11)

Ct FAM
(HPV 6)

1

32,28

31,17

32,89

29,68

2

23,60

24,02

31,18

28,49

3

31,68

32,11

30,16

4

24,42

25,26

31,50

31,84

5

31,00

30,72

32,28

32,96

6

31,96

31,83

32,93

30,56

7

30,01

30,63

29,98

8

29,54

27,86

28,54

9

31,96

30,77

28,14

29,32

10

26,51

25,01

30,11

29,23

TCNCYH 115 (6) - 2018

Ct HEX
(HPV 11)

HPV6/11KLEPT

31,43

29,54
28,33

Ct Texas Red
(nội chuẩn)

69


TẠP CHÍ NGHIÊN CỨU Y HỌC

IV. BÀN LUẬN

HPV nguy cơ thấp khác để thử nghiệm, kết

Trong nghiên cứu này, chúng tôi đã xây
dựng thành công phương pháp phát hiện 2
type HPV nguy cơ thấp phổ biến nhất là HPV
6 và HPV 11 bằng kỹ thuật multiplex real time
PCR với master mix được tối ưu gồm nồng độ
mồi xuôi-ngược (5 pmol/phản ứng), Taqman
probe gắn huỳnh quang HEX (1 pmol/phản
ứng), cùng với việc phát hiện sự có mặt của
gen nội chuẩn β- actin thông qua tín hiệu
huỳnh quang Texas Red. Ở đây, chúng tôi
chủ đích thiết kế duy nhất một kênh màu
huỳnh quang HEX cho cả 2 type HPV 6 và
HPV 11 để trong tương lai có thể ghép cặp
với các kênh màu huỳnh quang khác như
FAM phát hiện các type HPV nguy cơ cao và
Cy5 phát hiện HPV 16/18 cho việc phát triển
phương pháp phát hiện đồng thời các type
HPV nguy cơ cao và thấp trên hệ thống máy
real time PCR 4 kênh màu. Ngoài ra, chúng tôi
đã nhân dòng thành công plasmid mang đoạn

quả bước đầu khi dùng bộ kit này trên các
mẫu đã được xác định có chứa các type HPV
nguy cơ cao và các virus, vi khuẩn gây bệnh
phổ biến khác hay được phát hiện bằng
phương pháp real time PCR trong các phòng
xét nghiệm sinh học phân tử tại bệnh viện cho
thấy độ đặc hiệu đạt được là 100%.
Với kỹ thuật phát triển, chúng tôi tạm tính
giá thành của master mix, mồi, probe chỉ
khoảng 40.000 VNĐ/phản ứng trong khi sinh
phẩm thương mại của Sacace HPV 6/11
REAL - TM Kit có giá thành 178.000VNĐ/phản
ứng. Mặc dù từ việc phát triển kỹ thuật đến
việc chế tạo và thương mại kit là cả một quá
trình dài tốn kém thời gian và chi phí chắc
chắn sẽ còn tăng lên, phương pháp multiplex
real time PCR sử dụng Taqman probe cải tiến
được phát triển trong nghiên cứu này rất có
tiềm năng ứng dụng trong việc chế tạo kit
sàng lọc HPV 6 và HPV 11 tại cộng đồng có
giá thành cạnh tranh với kit ngoại nhập. Đây là

gen đặc hiệu cho HPV 6 và HPV 11 để tạo

kết quả tiền đề để chúng tối tiếp tục phát triển

chuẩn dương cho phản ứng và đánh giá được

kỹ thuật phát hiện đồng thời 14 type HPV

ngưỡng phát hiện của phản ứng phát hiện

nguy cơ cao và 02 type nguy cơ thấp bằng kỹ

HPV 6 và HPV 11 là 5 copy/phản ứng 25 µL

thuật multiplex real time PCR, nhằm tầm soát

(tương đương với nồng độ DNA đầu vào là 1

các type HPV gây bệnh qua đường tình dục

copy/µl) dựa trên đường chuẩn hồi quy tuyến

và đánh giá hiệu quả vắcxin.

2

tính có độ tin cậy cao (R = 0,999). Ngưỡng
phát hiện của master mix chế tạo tốt hơn rất
nhiều so với master mix được công bố bởi tác

V. KẾT LUẬN
Trong nghiên cứu này, chúng tôi đã phát

giả Seaman và cộng sự (103 copy/ phản ứng

triển thành công kỹ thuật multiplex real time

25 µL) và tác giả Yu và cộng sự (10 copy/

PCR sử dụng Taqman probe cải tiến để phát

phản ứng 25 µL), và gần như tương đương

hiện 02 type HPV nguy cơ thấp thường gặp

với ngưỡng phát hiện của bộ sinh phẩm HPV

nhất là HPV 6 và HPV 11 với độ đặc hiệu

6/11 REAL - TM (2,5 copy/phản ứng 25 µL).

100% và độ nhạy đạt tới 5 copy/phản ứng 25

Kết quả trên mẫu thực cho thấy sự tương

µL, cao hơn so với một số công bố trên thế

đồng về % dương tính: âm tính (10: 20) cũng

giới. Kết quả bước đầu so sánh master mix

như giá trị chu kỳ ngưỡng Ct. Mặc dù chưa có

chế tạo trong nghiên cứu với sinh phẩm

điều kiện thu thập mẫu tham chiếu là các type

thương mại đạt chuẩn IVD châu Âu cho thấy

70

TCNCYH 115 (6) - 2018


TẠP CHÍ NGHIÊN CỨU Y HỌC
tương đồng về tỷ lệ mẫu dương tính:âm tính

persistence among children: Design, methods

(10:20) cũng như giá trị chu kỳ ngưỡng.

and preliminary results of the HERITAGE
study. Papillomavirus Res, 2, 145 - 152.

Lời cám ơn
Nhóm nghiên cứu chân thành cảm ơn
công ty cổ phần ANABIO R&D đã hỗ trợ kinh
phí để thực hiện nghiên cứu này, cảm ơn
PGS.TS.BS Lê Quang Vinh tại Bệnh viện Phụ
sản Trung ương, PGS.TS.BS. Nguyễn Lĩnh
Toàn tại Học viện Quân Y và ThS. BS. Trương
Thái Phương tại Bệnh viện Bạch Mai đã cung
cấp mẫu tham chiếu cho nghiên cứu này.

K.S.,

Dahlstrom

K.R.,

Cheng J.N et al (2015). HPV16 Antibodies as
Risk Factors for Oropharyngeal Cancer and
Their Association with Tumor HPV and
Smoking Status. Oral Oncol, 51, 662 - 667.
4. Liao S., Deng D., Zhang W. et al
(2012).

Human

papillomavirus 16/18

promotes cervical cancer

cell

of delivery. Virol. J, 9, 80. doi: 10.1186/1743422X-9-8.
9. Guimerà N., Lloveras B., Lindeman J.,
et al (2013). The occasional role of low-risk
human papillomaviruses 6, 11, 42, 44, and 70

results

1. Burd E.M (2003). Human Papillomavirus
and Cervical Cancer. Clin. Microbiol. Rev., 16,
1 - 17.
Anderson

papillomavirus from mothers to infants:
Relationship between infection rate and mode

in anogenital carcinoma defined by laser
capture microdissection/PCR methodology

TÀI LIỆU THAM KHẢO

3.

8. Park H., Lee S.W., Lee I.H et al (2012).
Rate of vertical transmission of human

E5

proliferation,

migration and invasion in vitro and accelerates

from

a

global

study.

Am. J. Surg. Pathol, 37, 1299 - 1310.
10. Forman D., de Martel C., Lacey C.J.,
et al (2012). Global Burden of Human
Papillomavirus
and
Related
Diseases.
Vaccine, 30,12 - 23.
11. Lindh M, Gorander S, Andersson E
et al (2007). Real-time Taqman PCR targeting
14 human papilloma virus types. J. Clin. Virol,
40, 321 - 324.
12. Seaman W.T., Andrews E., Couch M
et al (2010). Detection and quantitation of
HPV in genital and oral tissues and fluids by

tumor growth in vivo. Oncol. Rep, 29, 95 - 102.

real time PCR. Virol. J., 7,
10.1186/1743-422X-7-194.

5. Flores-Díaz E., Sereday K.A., Ferreira
S et al (2017). HPV-6 Molecular Variants
Association with the Development of Genital
Warts in Men: The HIM Study. J. Infect. Dis.,

13. Yu D., Chen Y., Wu S et al (2012).
Simultaneous Detection and Differentiation of
Human Papillomavirus Genotypes 6, 11, 16
and 18 by AllGlo Quadruplex Quantitative

215, 559 - 565.

PCR. PLoS ONE, 7, e48972. doi.org/10.1371/
journal.pone.0048972.

6. Lee S.M., Park J.S., Norwitz E.R et al
(2013). Risk of Vertical Transmission of
Human Papillomavirus throughout Pregnancy:
A Prospective Study. PLoS ONE, 8, e66368.
doi: 10.1371/journal.pone.0066368.
7. Trottier H., Mayrand M.H., Coutlée F
et al (2016). Human papillomavirus (HPV)
perinatal transmission and risk of HPV
TCNCYH 115 (6) - 2018

194. doi:

14. Nguyen V.D., Christopher V., Chu
C.H et al (2016). Validation of a novel realtime PCR assay for detection of HLA-B*15:02
allele for prevention of carbamazepine–
Induced Stevens-Johnson syndrome/Toxic
Epidermal Necrolysis in individuals of Asian
ancestry, Hum. Immunol, 77, 1140 - 1146.
71


TẠP CHÍ NGHIÊN CỨU Y HỌC

Summary
DETECTION OF LOW-RISK HPV TYPE 6 AND 11 BY MULTIPLEX REAL
TIME PCR USING MODIFIED TAQMAN PROBES
Human papillomaviruses (HPVs) are common sexually transmitted infections, having two
major sub-types: oncogenic (or high-risk) causing cancers and non-oncogenic (or low-risk)
causing different types of skin and mucosal diseases with high incidence and recurrence.
Currently, commercial imported test kits for low-risk types are available; however, their expensive
costs limit its usage as a screening test, which is particularly true for settings dependent upon
health insurance programs. In this study, we successfully developed a new and lower cost
multiplex real time PCR method and a kit for detecting the two most common types of low-risk
HPV types including HPV 6 and HPV 11 at sensitivity of 5 copies/25 µL reaction, using Taqman
probes modified with ZEN quencher dye near 5’-end of HEX channel for screening low-risk types
6/11 and Texas Red Taqman probe for detection of β-globin internal control gene. The new assay
was used in parallel with the commercial kit (HPV 6/11 Real-TM, Sacace, Italy) to detect HPV6/11
in a set of 30 DNA samples extracted from 30 vaginal swab specimens. The result showed comparable threshold cycles and the percentage of positives.
Keywords: HPV, low-risk, real time PCR Taqman, vaginal swab

72

TCNCYH 115 (6) - 2018



Tài liệu bạn tìm kiếm đã sẵn sàng tải về

Tải bản đầy đủ ngay

×